Data from: Characterisation of a cold-adapted, thermostable glucokinase from psychrophilic Pseudoalteromonas sp. AS-131 reveals how the enzyme achieves high thermal stability without loss of cold adaptation
Data files
Dec 05, 2025 version files 9.56 MB
-
Fig2a_specific_activity_EcGK_WT.csv
204 B
-
Fig2a_specific_activity_PsGK_WT.csv
235 B
-
Fig2b_residual_activity_EcGK_WT_45℃.csv
145 B
-
Fig2b_residual_activity_EcGK_WT_50℃.csv
95 B
-
Fig2b_residual_activity_EcGK_WT_55℃.csv
61 B
-
Fig2b_residual_activity_PsGK_WT_55℃.csv
151 B
-
Fig2b_residual_activity_PsGK_WT_60℃.csv
152 B
-
Fig2b_residual_activity_PsGK_WT_65℃.csv
123 B
-
Fig2b_residual_activity_PsGK_WT_70℃.csv
82 B
-
Fig2c_thermal_stability_EcGK_WT_exp.csv
5.22 KB
-
Fig2c_thermal_stability_EcGK_WT_fit.csv
9.43 KB
-
Fig2c_thermal_stability_PsGK_WT_exp.csv
6.77 KB
-
Fig2c_thermal_stability_PsGK_WT_fit.csv
9.45 KB
-
Fig3c_DTNB_EcGK_C20S.csv
2.03 MB
-
Fig3c_DTNB_EcGK_C60S.csv
2.03 MB
-
Fig3c_DTNB_EcGK_C65S.csv
2.03 MB
-
Fig3c_DTNB_EcGK_WT.csv
2.03 MB
-
Fig3d_DTNB_PsGK_C156S.csv
67.38 KB
-
Fig3d_DTNB_PsGK_WT.csv
67.31 KB
-
Fig4_thermal_stability_PsGK_C325S_exp.csv
6.79 KB
-
Fig4_thermal_stability_PsGK_C325S_fit.csv
9.45 KB
-
Fig4_thermal_stability_PsGK_WT_exp.csv
6.77 KB
-
Fig4_thermal_stability_PsGK_WT_fit.csv
9.45 KB
-
Fig5b_DTNB_EcGK_DS-H.csv
186.04 KB
-
Fig5b_DTNB_EcGK_DS-L.csv
186.04 KB
-
Fig5b_DTNB_EcGK_DS-S.csv
186.04 KB
-
Fig5b_DTNB_EcGK_H312C.csv
186.64 KB
-
Fig5b_DTNB_EcGK_WT.csv
186.04 KB
-
Fig5c_thermal_stability_EcGK_DS-H_exp.csv
5.19 KB
-
Fig5c_thermal_stability_EcGK_DS-H_fit.csv
9.53 KB
-
Fig5c_thermal_stability_EcGK_DS-L_exp.csv
5.19 KB
-
Fig5c_thermal_stability_EcGK_DS-L_fit.csv
9.56 KB
-
Fig5c_thermal_stability_EcGK_DS-S_exp.csv
5.21 KB
-
Fig5c_thermal_stability_EcGK_DS-S_fit.csv
9.44 KB
-
FigS10a_SG-SG_DS-L.csv
68.44 KB
-
FigS10b_SG-SG_DS-S.csv
68.40 KB
-
FigS10c_SG-SG_DS-S.csv
68.44 KB
-
FigS11_CD_EcGK_DS-H.csv
9.67 KB
-
FigS11_CD_EcGK_DS-L.csv
9.68 KB
-
FigS11_CD_EcGK_DS-S.csv
9.65 KB
-
FigS11_CD_EcGK_WT.csv
9.66 KB
-
FigS13_specific_activity_EcGK_DS-S.csv
237 B
-
FigS13_specific_activity_EcGK_WT.csv
220 B
-
FigS4_relative_activity_EcGK_WT.csv
163 B
-
FigS4_relative_activity_PsGK_WT.csv
193 B
-
FigS5_Arrhenius_EcGK_WT.csv
160 B
-
FigS5_Arrhenius_PsGK_WT.csv
160 B
-
FigS6_residual_activity_EcGK_WT_45℃.csv
157 B
-
FigS6_residual_activity_EcGK_WT_50℃.csv
152 B
-
FigS6_residual_activity_EcGK_WT_55℃.csv
150 B
-
FigS6_residual_activity_PsGK_WT_55℃.csv
157 B
-
FigS6_residual_activity_PsGK_WT_60℃.csv
157 B
-
FigS6_residual_activity_PsGK_WT_65℃.csv
153 B
-
FigS6_residual_activity_PsGK_WT_70℃.csv
151 B
-
FigS7a_residual_activity_EcGK_WT.csv
223 B
-
FigS7a_residual_activity_PsGK_WT.csv
283 B
-
FigS7b_residual_activity_PsGK_WT_exp.csv
283 B
-
FigS7b_residual_activity_PsGK_WT_fit.csv
2.55 KB
-
FigS7c_residual_activity_EcGK_WT_exp.csv
223 B
-
FigS7c_residual_activity_EcGK_WT_fit.csv
2.52 KB
-
FigS9_relative_activity_PsGK_C325S.csv
176 B
-
FigS9_relative_activity_PsGK_WT.csv
176 B
-
FigS9_specific_activity_PsGK_C325S.csv
270 B
-
FigS9_specific_activity_PsGK_WT.csv
251 B
-
README.md
18.67 KB
Abstract
Microorganisms living in cold environments such as the Antarctic and deep sea usually possess cold-adapted enzymes, which are known to have high catalytic efficiency and low stability owing to their flexible structures. Research on cold-adapted enzymes has not progressed much due to the challenge of these enzymes being less stable. However, several cold-adapted enzymes with high thermal stability have recently been reported. In this study, we investigated the biochemical properties of glucokinases from the psychrophilic Pseudoalteromonas sp. AS-131 (PsGK) isolated from the Antarctic Ocean and mesophilic Escherichia coli (EcGK). We demonstrated that PsGK is a cold-adapted enzyme with high thermal stability. A comparison of the crystal structures and spectroscopic studies revealed that PsGK has an additional disulfide bond connecting the N- and C-termini. To test whether this bond is important for stability, we prepared a PsGK variant by removing the bond and observed a significant reduction in thermal stability. In addition, the introduction of the artificial disulfide bonds in homologous positions in EcGK increased the thermal stability without the reduction of maximum activity. These results confirmed that the introduction of a disulfide bond at the proper position, such as the connection of the N- and C-termini, significantly improved stability without changing the nature of enzymes. Our findings propose a new strategy that will contribute to the industrial application of enzymes.
Dataset DOI: 10.5061/dryad.ncjsxkt6b
Description of the data and file structure
Files and variables
File: Fig2a_specific_activity_EcGK_WT.csv
Description: Characterisation of glucokinase from glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Temp:0-65
- U/mg:0-40
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_EcGK_WT_50℃.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity:0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_EcGK_WT_55℃.csv
Description: Characterisation of glucokinase from glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity:0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_EcGK_WT_45℃.csv
Description: Characterisation of glucokinase from glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity:0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2a_specific_activity_PsGK_WT.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- U/mg:0-80
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_PsGK_WT_55℃.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity:0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_PsGK_WT_60℃.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity :0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_PsGK_WT_65℃.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity:0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2b_residual_activity_PsGK_WT_70℃.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- Log of residual activity:0-2
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig2c_thermal_stability_EcGK_WT_exp.csv
Description: Characterisation of glucokinase from glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Temperature:5-70
- Fraction unfolded:-0.2-1.2
File: Fig2c_thermal_stability_EcGK_WT_fit.csv
Description: Characterisation of glucokinase from glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Temperature:0-70
- Fraction unfolded:0-1
File: Fig2c_thermal_stability_PsGK_WT_exp.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temperature:5-90
- Fraction unfolded:-0.2-1.2
File: Fig2c_thermal_stability_PsGK_WT_fit.csv
Description: Characterisation of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temperature:5-90
- Fraction unfolded:0-1
File: Fig3c_DTNB_EcGK_C20S.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase from Escherichia coli (EcGK) C20S
Variables
- Reaction time (s):0-43250
- Number of cysteine:0-3
File: Fig3c_DTNB_EcGK_C60S.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase from Escherichia coli (EcGK) C60S
Variables
- Reaction time (s):0-43250
- Number of cysteine:0-3
File: Fig3c_DTNB_EcGK_C65S.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase from Escherichia coli (EcGK) C65S
Variables
- Reaction time (s):0-43250
- Number of cysteine:0-2
File: Fig3c_DTNB_EcGK_WT.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase fromEscherichia coli (EcGK) wild type (WT)
Variables
- Reaction time (s):0-43250
- Number of cysteine:0-4
File: Fig4_thermal_stability_PsGK_C325S_exp.csv
Description: Thermal melting curves of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) C325S
Variables
- Temperature: 5-90
- Fraction unfolded:-0.2-1.2
File: Fig4_thermal_stability_PsGK_C325S_fit.csv
Description: Thermal melting curves of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) C325S
Variables
- Temperature:5-90
- Fraction unfolded:0-1
File: Fig4_thermal_stability_PsGK_WT_exp.csv
Description: Thermal melting curves of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temperature:5-90
- Fraction unfolded:-0.2-1.2
File: Fig4_thermal_stability_PsGK_WT_fit.csv
Description: Thermal melting curves of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temperature:5-90
- Fraction unfolded:0-1
File: Fig5b_DTNB_EcGK_DS-H.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase from Escherichia coli (EcGK) C20S C65S H312C (DS-H)
Variables
- Reaction time (s):0-11100
- Number of cysteine:0-2
File: Fig5b_DTNB_EcGK_DS-L.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase fromEscherichia coli (EcGK) C20S C65S L313C (DS-L)
Variables
- Reaction time (s):0-11100
- Number of cysteine:0-2
File: Fig5b_DTNB_EcGK_DS-S.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase fromEscherichia coli (EcGK) C20S C65S S309C (DS-S)
Variables
- Reaction time (s):0-11100
- Number of cysteine:0-2
File: Fig5b_DTNB_EcGK_H312C.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase fromEscherichia coli (EcGK) H312C
Variables
- Reaction time (s):0-11100
- Number of cysteine:0-4
File: Fig5c_thermal_stability_EcGK_DS-H_exp.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S H312C (DS-H)
Variables
- Temperature:5-70
- Fraction unfolded:-0.2-1.2
File: Fig5c_thermal_stability_EcGK_DS-H_fit.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S H312C (DS-H)
Variables
- Temperature:5-70
- Fraction unfolded:0-1
File: Fig5c_thermal_stability_EcGK_DS-L_exp.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S L313C (DS-L)
Variables
- Temperature:5-70
- Fraction unfolded:-0.2-1.2
File: Fig5c_thermal_stability_EcGK_DS-L_fit.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S L313C (DS-L)
Variables
- Temperature:5-70
- Fraction unfolded:0-1
File: Fig5c_thermal_stability_EcGK_DS-S_exp.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S S309C (DS-S)
Variables
- Temperature:5-70
- Fraction unfolded:-0.2-1.2
File: Fig5c_thermal_stability_EcGK_DS-S_fit.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S S309C (DS-S)
Variables
- Temperature:5-70
- Fraction unfolded:0-1
File: FigS11_CD_EcGK_DS-H.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S H312C (DS-H)
Variables
- wavelength (nm):200-260
- Ellipticity (mdeg):-30-10
File: FigS11_CD_EcGK_DS-L.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S L313C (DS-L)
Variables
- wavelength (nm):200-260
- Ellipticity (mdeg):-30-10
File: FigS11_CD_EcGK_DS-S.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) C20S C65S S309C (DS-S)
Variables
- wavelength (nm):200-260
- Ellipticity (mdeg):-30-10
File: FigS11_CD_EcGK_WT.csv
Description: Thermal melting curves of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- wavelength (nm):200-260
- Ellipticity (mdeg):-30-10
File: FigS10b_SG-SG_DS-S.csv
Description: The distance between cysteine sulphur (SG) atoms glucokinase from Escherichia coli (EcGK) C20S C65S S309C (DS-S)
Variables
- Time (ns):0-50
- distance (Å):0-6
File: FigS10a_SG-SG_DS-L.csv
Description: The distance between cysteine sulphur (SG) atoms glucokinase from Escherichia coli (EcGK) C20S C65S L313C (DS-L)
Variables
- Time (ns):0-50
- distance (Å):0-8
File: FigS10c_SG-SG_DS-S.csv
Description: The distance between cysteine sulphur (SG) atoms glucokinase from Escherichia coli (EcGK) C20S C65S S309C (DS-S) containing pre-formed disulfide bond
Variables
- Time (ns):0-50
- distance (Å):0-5
File: FigS4_relative_activity_PsGK_WT.csv
Description: Plot of relative activity as a function of temperature of Pseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- Relative activity:0-1
File: FigS5_Arrhenius_EcGK_WT.csv
Description: Arrhenius plot of the substrate turnover (kcat) of glucokinase fromEscherichia coli (EcGK)
Variables
- 1000/Temperature (K):3.2-3.65
- ln kcat:2-5
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS5_Arrhenius_PsGK_WT.csv
Description: Arrhenius plot of the substrate turnover (kcat) of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK)
Variables
- 1000/Temperature (K):3.2-3.65
- ln kcat:2-5
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS13_specific_activity_EcGK_DS-S.csv
Description: Plot of specific activity of glucokinase fromEscherichia coli (EcGK) C20S C65S S309C (DS-S) as a function of temperature
Variables
- Temp:0-70
- U/mg:0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS13_specific_activity_EcGK_WT.csv
Description: Plot of specific activity of glucokinase fromEscherichia coli (EcGK) wild type (WT) as a function of temperature
Variables
- Temp:0-65
- U/mg:0-40
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS4_relative_activity_EcGK_WT.csv
Description: Plot of relative activity as a function of temperature of Escherichia coli (EcGK) wild type (WT)
Variables
- Temp:0-65
- Relative activity:0-1
File: FigS6_residual_activity_PsGK_WT_70℃.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS6_residual_activity_EcGK_WT_45℃.csv
Description: Thermal stability of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS6_residual_activity_EcGK_WT_50℃.csv
Description: Thermal stability of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS6_residual_activity_EcGK_WT_55℃.csv
Description: Thermal stability of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS6_residual_activity_PsGK_WT_65℃.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS6_residual_activity_PsGK_WT_55℃.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS6_residual_activity_PsGK_WT_60℃.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Time (min):0-60
- residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS7a_residual_activity_PsGK_WT.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- Residual activity (%):0-120
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS7b_residual_activity_PsGK_WT_exp.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- Residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS7b_residual_activity_PsGK_WT_fit.csv
Description: Thermal stability of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- Residual activity (%):0-100
File: FigS7c_residual_activity_EcGK_WT_exp.csv
Description: Thermal stability of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Temp:0-60
- Residual activity (%):0-100
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS7c_residual_activity_EcGK_WT_fit.csv
Description: Thermal stability of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Temp:0-60
- Residual activity (%):0-100
File: FigS7a_residual_activity_EcGK_WT.csv
Description: Thermal stability of glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Temp:0-60
- Residual activity (%):0-120
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS9_relative_activity_PsGK_C325S.csv
Description: Relative activity of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) C325S
Variables
- Temp:0-80
- relative activity:0-1
File: FigS9_relative_activity_PsGK_WT.csv
Description: Relative activity of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- relative activity:0-1
File: FigS9_specific_activity_PsGK_C325S.csv
Description: Specific activity of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) C325S
Variables
- Temp:0-80
- U/mg:0-140
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: FigS9_specific_activity_PsGK_WT.csv
Description: Specific activity of glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Temp:0-80
- U/mg:0-80
- SD:The values represent mean values ± standard deviation of three independent experiments (n = 3).
File: Fig3d_DTNB_PsGK_C156S.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) C156S
Variables
- Reaction time (s):0-43250
- Number of cysteine:0-1
File: Fig5b_DTNB_EcGK_WT.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase from Escherichia coli (EcGK) wild type (WT)
Variables
- Reaction time (s):0-11100
- Number of cysteine:0-4
File: Fig3d_DTNB_PsGK_WT.csv
Description: Time dependence of 5’5’-dithiobis(2-nitrobenzonate) (DTNB) reaction for glucokinase fromPseudoalteromonas sp. AS-131 (PsGK) wild type (WT)
Variables
- Reaction time (s):0-43250
- Number of cysteine:0-2
Supplemental information uploaded to Zenodo:
PsGK_SI_revised_clean.docs contains the supplementary tables and figures with respective legends.
Cloning, expression, and purification
It was assumed that the genes of Pseudoalteromonas sp. AS-131 would be highly conserved with those of Pseudoalteromonas haloplanktis TAC125 since one of the DNA sequences, alkaline protease gene (fpa), from AS-131 exhibited 99% identity to the fpa gene of TAC125. Subsequently, the nucleotide sequence of the glucokinase gene in AS-131 was identified using the phglk sequence from TAC125. The protein encoded by this gene (UniProt ID: H7CHS4) was referred to as PsGK in this study. For the comparison with PsGK, the genome sequence of Escherichia coli K-12 was obtained from GenBank, and the glucokinase gene (glk) was identified. The protein encoded by glk (UniProt ID: P0A6V8) was referred to as EcGK.
PsGK and EcGK DNAs were cloned into the expression vector pET-16b by homologous recombination using a yeast-based in vivo cloning method. These DNAs were amplified by PCR using the following primers: a forward primer, 5′-TGTTTAACTTTAAGAAGGAGATATACCATGAGCTTACACTCTTCTGCC-3′, and a reverse primer, 3′- CGCAGCTTCCTTTCGGGCTTTGTTAGCAGCTTATTCCTGCTTACTATTATGCAAACAC-5′ (NOTE: underlined and bold sequences represent homologs of the pET-16b vector start and stop codon, respectively). The amplified DNA fragment and pET-16b vector digested with BamHI were mixed, and Saccharomyces cerevisiae YPH499 competent cells were transformed. Recombinant plasmid DNA was isolated from S. cerevisiae using the QIAprep Miniprep Kit (Qiagen).
The rescued plasmid was transformed into Escherichia coli (E. coli) DH5α for propagation. The recombinant plasmid was transferred to E. coli DH5α. The recombinant plasmid DNA isolated from E. coli DH5α was transformed into E. coli BL21 (DE3) for expression. Similarly, the gene encoding EcGK was amplified by PCR from the genomic DNA of E. coli K-12 obtained from GenBank and cloned into the expression vector pET-16b. In addition, PsGK C156S, EcGK C20S, EcGK C60S, and EcGK C65S, for the identification of cysteines exposed to solution, and PsGK C325S, EcGK H312C, EcGK C20S C65S H312C, EcGK C20S C65S L313C, and EcGK C20S C65S S309C, for CD spectroscopy, were synthesised by GenScript Biotech and cloned into the expression vector pET-16b digested with NcoI and BamHI.
E. coli BL21 (DE3) was purchased from Funakoshi and transformed with the expression vector, inoculated into LB medium containing 50 µg/mL of ampicillin, and grown at 37°C until OD660nm was 0.6-1.0. Isopropyl-1-thio-β-D-galactopyranoside (IPTG) was added to the culture medium (a final concentration of 1.0 mM), and protein expression was induced at 20°C for 24 h. All conditions for culturing were optimised to achieve high expression of GK. The harvested cells were suspended in 20 mM Tris-HCl buffer (pH 7.6) containing 10 mM MgCl2, followed by the addition of dithiothreitol (DTT), phenylmethylsulfonyl fluoride, and lysozyme were added to the cell suspension(final concentrations of 1.0 mM, 1.0 mM, and 0.08%, respectively), and incubated on ice for approximately 20 min. Sodium deoxycholate was added at the final concentration of 0.2% and stored at -80°C. The cell suspension was then disrupted by freezing and thawing. Streptomycin was added to the suspension at a final concentration of 2.0% to remove nucleic acids. The suspension was gently stirred and centrifuged at 10,000 rpm for 20 minutes. The supernatant was collected and subjected to ammonium sulfate fractionation. The active fractions of 20-50% and 30-60% ammonium sulfate saturation for PsGK and EcGK, respectively, were collected and dialysed with 20 mM Tris-HCl buffer (pH 7.6) containing 10 mM MgCl2 and 5 mM β-mercaptoethanol. The dialysed samples were loaded onto the anion-exchange chromatography using HiTrap Q HP (Cytiv, a) and the bound protein was eluted with a linear gradient of KCl (0 to 300 mM in 20 mM Tris-HCl buffer (pH 7.6) containing 10 mM MgCl2 and 5 mM β-mercaptoethanol). The expression and purity of PsGK and EcGK were assessed by SDS-PAGE. The molecular weights of the purified PsGK WT and EcGK WT were estimated by gel filtration using a HiLoad 16/60 Superdex 200 prep grade column (Cytiva). Protein concentration was determined by measuring the absorbance at 280 nm (ε280nm = 21.4 mM/cm and 28.4 mM/cm for PsGK and EcGK, respectively).
Activity assay
The glucokinase activity was measured using a two-step reaction. For the first step, a reaction mixture containing 10 µL of enzyme and 290 µL of substrate (5 mM glucose and 2 mM ATP) in 20 mM Tris-HCl buffer (pH 7.6) containing 10 mM MgCl2 and 1 mM DTT was incubated for 5 min at various temperatures (1-80°C). The reaction was stopped by the addition of 15 µL of 50% (w/w) trichloroacetic acid and neutralised by the addition of 30 µL of 2 M Tris. In the second step, a reaction mixture from the first step and 50 µM d-glucose 6-phosphate dehydrogenase (G6PD) in 20 mM Tris-HCl buffer (pH 7.6) containing 10 mM MgCl2 and 1.2 mM NADP+ was incubated for 20-30 min at room temperature. The amount of glucose 6-phosphate produced by glucokinase was estimated by measuring the absorbance of NADPH, the product of the second step, at 340 nm using a microplate reader (Thermo Scientific). One unit of glucokinase activity was defined as the enzymatic activity required to phosphorylate 1.0 µmol of glucose to 1.0 µmol glucose 6-phosphate per minute under the described conditions.
Thermal stability
The thermal stability of the glucokinases was determined by measuring residual activity and CD spectroscopy. Residual activities were determined by the following two experiments. In the first experiment, the enzyme solutions were heated at various temperatures ranging from 45 to 70°C for up to 60 min. At each temperature, samples were taken every 10 min, rapidly cooled on ice. Residual activity was determined under the optimum reaction conditions for each enzyme, with the initial activity at zero time defined as 100%. The kd was determined from the slope of a plot of the log of residual activity against time. In the second experiment, the residual activities were measured at optimum conditions after pre-incubation at various temperatures for 10 min in a 20 mM Tris-HCl (pH 7.6) buffer containing 10 mM MgCl2, evaluated with the specific activity at optimum conditions as 100%. To estimate the T50, the residual activity measured over time was fitted to a logistic regression model.
CD measurements were performed using a Jasco J-1500 spectropolarimeter at the Institute for Molecular Science, Okazaki, equipped with a Peltier cell holder and a PTC-510 temperature controller using a quartz cell with 0.1 mm path length (Jasco). To assess the secondary structure, CD spectra were collected at 20°C in the wavelength range of 200-260 nm. The measurement parameters were set as follows: 0.1 nm data pitch, 20 nm/min scanning speed, 1 nm band width, 1 s response time, and 100 mdeg sensitivity. The enzymes were prepared in 10 mM potassium phosphate buffer (pH 7.6) at a concentration of 5 µM. For thermal denaturation analysis, the ellipticity at 222 nm was monitored while gradually increasing the temperature from 5 to 90°C, with data recorded at 0.2°C intervals under continuous temperature control by the Peltier device. The unfolding curves were analysed using a sigmoidal curve function, according to Rünzler et al.
Where θT is the ellipticity at temperature T, mT is the slope of the curve within the transition region, and the inflection point of the curve represents the melting temperature Tm. The Tm values were calculated from these thermal melting curves. The fitting errors of Tm were used as the standard errors of the measurements. At each temperature, bN and bD can be extrapolated from the pre- and post-transition baselines, (mN × T - bN) and (mD × T - bD), respectively. The fraction of unfolded proteins was calculated by subtracting the baseline values.
Kinetic parameter
Km and kcat of PsGK and EcGK were measured at 1, 25, and 40°C in 20 mM Tris-HCl (pH 7.6) buffer containing 10 mM MgCl2, 5 mM glucose, 2 mM ATP, 1 mM DTT, 1.2 mM nicotinamide adenine dinucleotide phosphate (NADP+,) and 50 µM G6PD. The concentrations of glucose and ATP varied from 0.17 to 1.0 mM. Km and kcat for each substrate were determined by steady-state experiments performed at 1, 25, and 40°C in assay buffer containing 20 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 1 mM DTT, 1.2 mM NADP+, 50 µM G6PD, and various concentrations of glucose and ATP, using Lineweaver-Burk plots based on Michaelis-Menten enzyme kinetics. The values represent mean values ± standard deviation of three independent experiments in Table 1.
Thermodynamic parameter
The Ea of the reaction catalysed by PsGK and EcGK were calculated by measuring the slope of the Arrhenius plot, which was made based on the kcat values at 1-40°C. kcat values used in the Arrhenius plot were calculated based on the reaction rates measured at given temperatures. The thermodynamic activation parameters of PsGK and EcGK at 25°C were calculated using respective equations.
DTNB method
Ellman’s reagent, DTNB, has the ability to bind to the free thiol groups by cleaving its own disulfide bond and releasing 5-mercapto-2-nitrobenzoic acid (TNB). Spontaneously, TNB is ionised to the TNB2- dianion in water at neutral and alkaline pH. As DTNB is reacted with the free thiol group of cysteine at a one-to-one ratio, the concentration of free thiol groups can be quantified by measuring the absorbance of TNB2-. Furthermore, DTNB reacts slowly or does not react with free cysteine residues inside the enzyme, depending on the degree of structural flexibility. To avoid the reaction of DTNB with the reductant, β-mercaptoethanol in the samples was removed using a desalting spin column (APRO Science group). DTNB was dissolved in 10 mM phosphate buffer (pH 6.5) to a final concentration of 4 mM. The mixing ratio of enzyme, 0.1 M Tris-HCl buffer (pH 8.0) containing 1 mM ethylenediaminetetraacetic acid, was adjusted by the number of expected free cysteine residues so that the absorbance at 412 nm of TNB2- (λmax = 412 nm, ε = 14,150 M-1cm-1) was approximately 0.2 per one cysteine residue. DTNB was added at a molar amount 20-fold greater than that of the enzyme. The reaction mixture was initiated to react for 1 min, and then started to record the absorbance was recorded at 412 nm for 5-10 min. After 3-12 h, the absorbance was measured at 412 nm.
Molecular dynamics
MD simulations were performed using the AMBER16 program package. The protein structure was obtained from the Protein Data Bank (PDB ID: 1Q18), and specific amino acid residues were replaced with cysteines (S309C and L313C) to allow disulfide bond formation. The disulfide bond was explicitly defined using the bond command in LEaP. The ff14SB all-atom force field was applied. Water was modeled by the TIP3P potential, and a protein molecule was surrounded by a periodic octahedral box of TIP3P water molecules. Na+⁺ counterions were added to neutralise the system. All Lennard-Jones interactions were cut off at a distance of 10 Å, and long-range electrostatic interactions were calculated using a particle mesh Ewald method. The MD simulations were set up using the following protocol. First, 1000 steps of energy minimisation were performed to remove close van der Waals contacts present in the initial structure and to allow the formation of hydrogen bonds between solvent molecules and the protein. In this stage, the protein was kept fixed, and only the positions of water molecules were minimised. In the second step, an unrestrained energy minimisation for 2,500 steps was performed, in which the entire system was minimised. As the third step, the system was then gradually heated to 300 K over 20 ps under constant volume conditions. The temperature was controlled using Langevin dynamics with a collision frequency of 1.0 ps⁻¹. To constrain bonds involving hydrogen atoms, the SHAKE algorithm was employed, and the time integration step was set to 2 fs. After heating, the system was simulated for 50 ns under constant temperature (300 K) and pressure (1 atm) conditions, using a time step of 2 fs. The distance between the SG of the cysteine residues forming the disulfide bond was extracted from all simulation frames and analysed to evaluate its time-dependent variation.