Data from: Using a comprehensive DNA barcode library to detect novel egg and larval host plant associations in a Cephaloleia Rolled-leaf Beetle (Coleoptera: Chrysomelidae)

Garcia-Robledo C, Kuprewicz EK, Staines CL, Kress WJ, Erwin TL

Date Published: April 29, 2013



Files in this package

Content in the Dryad Digital Repository is offered "as is." By downloading files, you agree to the Dryad Terms of Service. To the extent possible under law, the authors have waived all copyright and related or neighboring rights to this data. CC0 (opens a new window) Open Data (opens a new window)

Title Samples included in DNA barcode analyses
Downloaded 44 times
Description Supplement S1. Samples included in DNA barcode analyses. Tables summarize collection information, the life stage of each sample (egg, larva or adult), host plant family / species and sequence quality (percentage of untrimmed bases of high-quality, HQ%). DNA amplifications were performed with the Folmer primers: GGTCAACAAATCATAAAGATATTGG (F) and TAAACTTCAGGGTGACCAAAAAATCA (R).
Download SuppInfo.doc (266.2 Kb)
Details View File Details
Title DNA sequences (COI) of limited quality and not deposited in GenBank (FASTA format).
Downloaded 37 times
Description Supplement S2. DNA sequences (COI) of limited quality and not deposited in GenBank (FASTA format). Sequences in this supplement were included in the analyses as they successfully identified individuals to the species level with 100% confidence. Numbers at the beginning of each sequence represent collection numbers. Information for each collection was included in Supplement S1.
Download SuppInfo2.doc (69.63 Kb)
Details View File Details

When using this data, please cite the original publication:

Garcia-Robledo C, Kuprewicz EK, Staines CL, Kress WJ, Erwin TL (2013) Using a comprehensive DNA barcode library to detect novel egg and larval host plant associations in a Cephaloleia Rolled-leaf Beetle (Coleoptera: Chrysomelidae). Biological Journal of the Linnean Society 110(1): 189-198.

Additionally, please cite the Dryad data package:

Garcia-Robledo C, Kuprewicz EK, Staines CL, Kress WJ, Erwin TL (2013) Data from: Using a comprehensive DNA barcode library to detect novel egg and larval host plant associations in a Cephaloleia Rolled-leaf Beetle (Coleoptera: Chrysomelidae). Dryad Digital Repository.
Cite | Share
Download the data package citation in the following formats:
   RIS (compatible with EndNote, Reference Manager, ProCite, RefWorks)
   BibTex (compatible with BibDesk, LaTeX)

Search for data

Be part of Dryad

We encourage organizations to: