Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA

Capo E, Debroas D, Arnaud F, Guillemot T, Bichet V, Millet L, Gauthier E, Massa C, Develle A, Pignol C, Lejzerowicz F, Domaizon I

Date Published: October 21, 2016

DOI: http://dx.doi.org/10.5061/dryad.6vd87

 

Files in this package

Content in the Dryad Digital Repository is offered "as is." By downloading files, you agree to the Dryad Terms of Service. To the extent possible under law, the authors have waived all copyright and related or neighboring rights to this data. CC0 (opens a new window) Open Data (opens a new window)

Title seqAll_mixEUK
Downloaded 4 times
Description Demultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together using UPARSE tools (option -fastq_mergepairs with a minimal overlap equal to 150 and no mismatch allowed) (Edgar, 2013). and the merged sequences were then submitted to the following cleaning procedures: (i) no undefined bases (Ns), (ii) a minimum sequence length of 200 bp, and (iii) no sequencing error in the forward and reverse primers. Composition of the mock community: A50 Eukaryota;Rhizaria;Cercozoa; A31 Eukaryota;Alveolata;Perkinsea; A54 Eukaryota;Cryptophyceae A34 Eukaryota;Stramenopiles;Chrysophyceae; A44 Eukaryota;Fungi; PG5-14 Eukaryota;Archaeplastida;Chloroplastida;Chlorophyta;Chlorophyceae PG5-26 Eukaryota;Alveolata;Ciliophora; PG5-28 Eukaryota;Fungi;Cryptomycota; BI109 Eukaryota;Fungi;Cryptomycota; (LKM11 clade) B24 Eukaryota;Stramenopiles;Bicosoecida; B64 Eukaryota;Fungi;Chytridiomycota; B79 Eukaryota;Fungi;Dikarya; B26 Eukaryota;Alveolata;Perkinsozoa BA97 Eukaryota;Cryptophyta; B36 Eukaryota;Stramenopiles;Ochrophyta;Chrysophyceae; BA231 Eukaryota;Alveolata;Ciliophora;Alveolate_1;
Download seqAll_mixEUK.fasta (443.4 Kb)
Details View File Details
Title samples_strandplus.fas
Downloaded 3 times
Description Sample;Composite_depth (cm);Dating / Time (AD); BourgetAC0135C;1-2;2010-2012; BourgetAC0135E;1-2;2010-2012; BourgetAC0139D;9-10;1993-1995; BourgetAC0139E;9-10;1993-1995; BourgetAC0141D;13-14;1987-1989; BourgetAC0141E;13-14;1987-1989; BourgetAC0143D;17-18;1979-1981; BourgetAC0143E;17-18;1979-1981; BourgetAC0146C;24-25;1968-1970; BourgetAC0146E;24-25;1968-1970; BourgetAC0148C;28-29;1959-1961; BourgetAC0148E;28-29;1959-1961; BourgetAC0151D;33-34;1949-1951; BourgetAC0151E;33-34;1949-1951; BourgetAC011C;39-40;1938-1940; BourgetAC011D;39-40;1938-1940; BourgetAC013C;45-46;1927-1929; BourgetAC013D;45-46;1927-1929; BourgetAC015B;51-52;1914-1916; BourgetAC015D;51-52;1914-1916; BourgetAC017C;57-58;1901-1903; BourgetAC017D;57-58;1901-1903; BourgetAC021C;69-70;1871-1873; BourgetAC021D;69-70;1871-1873; BourgetAC023C;75-76;1854-1857; BourgetAC023D;75-76;1854-1857; BourgetAC025C;81-82;1837-1840; BourgetAC025D;81-82;1837-1840; BourgetAC027B;87-88;1819-1822; BourgetAC027D;87-88;1819-1822; BourgetAC029C;92-93;1805-1810; BourgetAC029D;92-93;1805-1810; BourgetAC033B;104-105;1760-1765; BourgetAC033D;104-105;1760-1765; BourgetAC037C;117-118;1700-1705; BourgetAC037D;117-118;1700-1705; BourgetAC040B;132-133;1595-1605; BourgetAC040C;132-133;1595-1605; BourgetAC042C;138-139;1545-1555; BourgetAC042D;138-139;1545-1555; BourgetAC048B;156-157;1385-1395; BourgetAC048D;156-157;1385-1395; BourgetAC052B;168-169;1290-1295; BourgetAC052D;168-169;1290-1295; BourgetAC056B;180-181;1205-1210; BourgetAC056D;180-181;1205-1210; BourgetAC060C;192-193;1135-1140; BourgetAC060D;192-193;1135-1140; BourgetAC064C;205-206;1070-1075; BourgetAC064D;205-206;1070-1075; BourgetAC068C;217-218;1020-1025; BourgetAC068D;217-218;1020-1025; BourgetAC072C;226-227;980-985; BourgetAC072D;226-227;980-985; BourgetAC080B;250-251;880-885; BourgetAC080D;250-251;880-885; BourgetAC082B;256-257;850-855; BourgetAC082C;256-257;850-855; BourgetAC084B;262-263;820-825; BourgetAC084D;262-263;820-825; BourgetAC086B;268-269;790-795; BourgetAC086D;268-269;790-795; BourgetAC088C;274-275;755-760; BourgetAC088D;274-275;755-760; BourgetAC090B;280-281;715-720; BourgetAC090C;280-281;715-720; BourgetAC092B;286-287;670-680; BourgetAC092D;286-287;670-680; BourgetAC096C;298-299;570-580; BourgetAC096D;298-299;570-580; BourgetAC098C;304-305;515-525; BourgetAC098D;304-305;515-525; BourgetAC0100C;310-311;455-465; BourgetAC0100E;310-311;455-465; BourgetAC0102C;316-317;390-400; BourgetAC0102D;316-317;390-400; BourgetAC0104C;322-323;325-335; BourgetAC0104D;322-323;325-335; BourgetAC0106B;328-329;255-265; BourgetAC0106C;328-329;255-265; BourgetAC0109B;338-339;135-145; BourgetAC0109C;338-339;135-145; BourgetAC0111B;343-344;80-90; BourgetAC0111D;343-344;80-90; BourgetAC0113B;349-350;15-25; BourgetAC0113C;349-350;15-25; BourgetAC0115C;355-356;-45/-35; BourgetAC0115D;355-356;-45/-35; BourgetAC0117B;361-362;-95/-85; BourgetAC0117C;361-362;-95/-85; IgalikuAC0I2A;0.5-1;2009-2010; IgalikuAC0I2B;0.5-1;2009-2010; IgalikuAC0I4A;1.5-2;2003-2005; IgalikuAC0I4B;1.5-2;2003-2005; IgalikuAC0I6A;2.5-3;1988-1997; IgalikuAC0I6B;2.5-3;1988-1997; IgalikuAC0I8A;3.5-4;1966-1974; IgalikuAC0I8B;3.5-4;1966-1974; IgalikuAC0I10A;4.5-5;1961-1963; IgalikuAC0I10B;4.5-5;1961-1963; IgalikuAC0I12A;5.5-6;1939-1954; IgalikuAC0I12B;5.5-6;1939-1954; IgalikuAC0I14A;6.5-7;1900-1920; IgalikuAC0I14B;6.5-7;1900-1920; IgalikuAC0I16A;7.5-8;1865-1880; IgalikuAC0I16B;7.5-8;1865-1880; IgalikuAC0I18A;8.5-9;1835-1850; IgalikuAC0I18B;8.5-9;1835-1850; IgalikuAC0I20A;9.5-10.5;1790-1820; IgalikuAC0I20B;9.5-10.5;1790-1820; IgalikuAC0I24A;13.5-14.5;1680-1725; IgalikuAC0I24B;13.5-14.5;1680-1725; IgalikuAC0I28A;17.5-18.5;1595-1605; IgalikuAC0I28B;17.5-18.5;1595-1605; IgalikuAC0I32A;21.5-22.5;1450-1490; IgalikuAC0I32B;21.5-22.5;1450-1490; IgalikuAC0I36A;25.5-26.5;1320-1345; IgalikuAC0I36B;25.5-26.5;1320-1345; IgalikuAC0I38A;27-27.5;1305-1315; IgalikuAC0I38B;27-27.5;1305-1315; IgalikuAC0I40A;28-28.5;1260-1290; IgalikuAC0I40B;28-28.5;1260-1290; IgalikuAC0I42A;29-29.5;1230-1240; IgalikuAC0I42B;29-29.5;1230-1240; IgalikuAC0I44A;30-30.5;1210-1220; IgalikuAC0I44B;30-30.5;1210-1220; IgalikuAC0I46A;31-31.5;1200-1205; IgalikuAC0I46B;31-31.5;1200-1205; IgalikuAC0I48A;32-32.5;1190-1195; IgalikuAC0I48B;32-32.5;1190-1195; IgalikuAC0I50A;33-33.5;1185-1190; IgalikuAC0I50B;33-33.5;1185-1190; IgalikuAC0I52A;34-34.5;1170-1180; IgalikuAC0I52B;34-34.5;1170-1180; IgalikuAC0I54A;35-35.5;1155-1165; IgalikuAC0I54B;35-35.5;1155-1165; IgalikuAC0I56A;36-36.5;1140-1150; IgalikuAC0I56B;36-36.5;1140-1150; IgalikuAC0I58A;37-37.5;1130-1135; IgalikuAC0I58B;37-37.5;1130-1135; IgalikuAC0I60A;38-38.5;1110-1120; IgalikuAC0I60B;38-38.5;1110-1120; IgalikuAC0I62A;39-39.5;1080-1095; IgalikuAC0I62B;39-39.5;1080-1095; IgalikuAC0I64A;40-40.5;1045-1055; IgalikuAC0I64B;40-40.5;1045-1055; IgalikuAC0I66A;41-41.5;1030-1035; IgalikuAC0I66B;41-41.5;1030-1035; IgalikuAC0I68A;42-42.5;1023-1026; IgalikuAC0I68B;42-42.5;1023-1026; IgalikuAC0I70A;43-43.5;1018-1021; IgalikuAC0I70B;43-43.5;1018-1021; IgalikuAC0I72A;44-44.5;1010-1015; IgalikuAC0I72B;44-44.5;1010-1015; IgalikuAC0I74A;45-45.5;990-1000; IgalikuAC0I74B;45-45.5;990-1000; IgalikuAC0I76A;46-46.6;960-975; IgalikuAC0I76B;46-46.6;960-975; IgalikuAC0I78A;47-47.5;925-940; IgalikuAC0I78B;47-47.5;925-940; IgalikuAC0I80A;48-48.5;900-910; IgalikuAC0I80B;48-48.5;900-910; IgalikuAC0I82A;49-49.5;890-895; IgalikuAC0I82B;49-49.5;890-895; IgalikuAC0I84A;50-50.5;875-880; IgalikuAC0I84B;50-50.5;875-880; IgalikuAC0I92A;57.5-58.5;685-700; IgalikuAC0I92B;57.5-58.5;685-700; IgalikuAC0I100A;65.5-66.5;360-370; IgalikuAC0I100B;65.5-66.5;360-370; IgalikuAC0I108A;73.5-74.5;80-95; IgalikuAC0I108B;73.5-74.5;80-95; IgalikuAC0I116A;81.5-82.5;-50/-40; IgalikuAC0I116B;81.5-82.5;-50/-40; IgalikuAC0I124A;89.5-90.5;-195/-180; IgalikuAC0I124B;89.5-90.5;-195/-180;
Download samples_strandplus.fas.gz (361.1 Mb)
Details View File Details

When using this data, please cite the original publication:

Capo E, Debroas D, Arnaud F, Guillemot T, Bichet V, Millet L, Gauthier E, Massa C, Develle A, Pignol C, Lejzerowicz F, Domaizon I (2016) Long-term dynamics in microbial eukaryotes communities: a palaeolimnological view based on sedimentary DNA. Molecular Ecology 25(23): 5925-5943. http://dx.doi.org/10.1111/mec.13893

Additionally, please cite the Dryad data package:

Capo E, Debroas D, Arnaud F, Guillemot T, Bichet V, Millet L, Gauthier E, Massa C, Develle A, Pignol C, Lejzerowicz F, Domaizon I (2016) Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA. Dryad Digital Repository. http://dx.doi.org/10.5061/dryad.6vd87
Cite | Share
Download the data package citation in the following formats:
   RIS (compatible with EndNote, Reference Manager, ProCite, RefWorks)
   BibTex (compatible with BibDesk, LaTeX)

Search for data

Be part of Dryad

We encourage organizations to: