Data from: The interaction of Saccharomyces paradoxus with its natural competitors on oak bark

Kowallik V, Miller E, Greig D

Date Published: February 24, 2015

DOI: http://dx.doi.org/10.5061/dryad.c8n18

 

Files in this package

Content in the Dryad Digital Repository is offered "as is." By downloading files, you agree to the Dryad Terms of Service. To the extent possible under law, the authors have waived all copyright and related or neighboring rights to this data. CC0 (opens a new window) Open Data (opens a new window)

Title ITS_taxonomy
Downloaded 7 times
Description Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the fungal ITS (ITS1, 5.8S and ITS2) sequences using ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers using the 454 GS FLX+ Titanium Sequencer (Roche). ITS sequences were processed with mothur and subsampled to 4000 sequences per sample. For taxonomic classification the mothur implementation of naive Bayesian classification was used with a threshold bootstrap value of 70% for each taxonomic level. The used fungal database was the “dynamic” mothur release from 08.12.2013 of the UNITE database.
Download ITS.tax.summary (52.83 Kb)
Details View File Details
Title ITS_OTU
Downloaded 2 times
Description Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the fungal ITS (ITS1, 5.8S and ITS2) sequences using ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers using the 454 GS FLX+ Titanium Sequencer (Roche). We used the “pairwise.seqs” command in mothur for the OTU-based analysis with ignoring the penalization of the sequence ends. The shared file shows the distribution of OTUs in the ten groups at 97% and 95% identity level.
Download ITS_OTU.shared (126.3 Kb)
Details View File Details
Title 16S_taxonomy
Downloaded 5 times
Description Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the bacterial 16S rRNA (V1 to V5) sequences using GM3 (AGAGTTTGATCMTGGC) and 926R (CCGTCAATTCMTTTGAGTTT) primers using the 454 GS FLX+ Titanium Sequencer (Roche). 16S sequences were processed with mother, aligned to the comprehensive seed database from SILVA downloaded on April 29, 2013 and subsampled to 4000 sequences per sample. Sequence classification was performed using the mothur implementation of naive Bayesian classification based on the RDP Classifier version 9, with a threshold bootstrap value of 70% for each taxonomic level.
Download 16S.tax.summary (16.65 Kb)
Details View File Details
Title 16S_OTU
Downloaded 5 times
Description Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the bacterial 16S rRNA (V1 to V5) sequences using GM3 (AGAGTTTGATCMTGGC) and 926R (CCGTCAATTCMTTTGAGTTT) primers using the 454 GS FLX+ Titanium Sequencer (Roche). 16S sequences were processed with mother, aligned to the comprehensive seed database from SILVA downloaded on April 29, 2013 and subsampled to 4000 sequences per sample. We created a distance matrix of aligned sequences and clustered them into operational taxonomic units (OTUs) using the average neighbor clustering algorithm. The shared file shows the distribution of OTUs in the ten groups at 97% and 95% identity level.
Download 16S_OTU.shared (142.1 Kb)
Details View File Details

When using this data, please cite the original publication:

Kowallik V, Miller E, Greig D (2015) The interaction of Saccharomyces paradoxus with its natural competitors on oak bark. Molecular Ecology 24(7): 1596-1610. http://dx.doi.org/10.1111/mec.13120

Additionally, please cite the Dryad data package:

Kowallik V, Miller E, Greig D (2015) Data from: The interaction of Saccharomyces paradoxus with its natural competitors on oak bark. Dryad Digital Repository. http://dx.doi.org/10.5061/dryad.c8n18
Cite | Share
Download the data package citation in the following formats:
   RIS (compatible with EndNote, Reference Manager, ProCite, RefWorks)
   BibTex (compatible with BibDesk, LaTeX)

Search for data

Be part of Dryad

We encourage organizations to: