Data from: Evidence for amino acid snorkeling from a high-resolution, in vivo analysis of Fis1 tail anchor insertion at the mitochondrial outer membrane

Keskin A, Akdoğan E, Dunn CD

Date Published: December 23, 2016

DOI: http://dx.doi.org/10.5061/dryad.j14r5

 

Files in this package

Content in the Dryad Digital Repository is offered "as is." By downloading files, you agree to the Dryad Terms of Service. To the extent possible under law, the authors have waived all copyright and related or neighboring rights to this data. CC0 (opens a new window) Open Data (opens a new window)

Title Keskin_AmpliconSequencingFis1TA
Downloaded 13 times
Description A pool of plasmids containing Fis1p TA mutations in a Gal4-sfGFP-Fis1 fusion protein and constructed using degenerate primers was cultured in strain MaV203 for four generations in SC-Trp medium, SC-Ura medium, or SMM-Trp-His medium containing 0 mM, 5 mM, 10 mM, or 20 mM 3-AT. Plasmids present under each culture condition were then recovered from 10 OD600 units of cells. Primers 882 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGTAGAGGATAAGATCCAGAAGGAAAC) and 883 (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATAAGAAATTCGCTTATTTAGAAGTG) were used to amplify the genomic region encoding the Fis1p TA from each plasmid pool. Using the provided PCR products, next-generation, paired-end sequencing was performed by Microsynth (Balgach, Switzerland) on a MiSeq Nano (2x150v2). GZIP-compressed FASTQ files and a commercial sequencing report are found in the associated ZIP file.
Download Keskin_AmpliconSequencingFis1TA.zip (364.2 Mb)
Details View File Details

When using this data, please cite the original publication:

Keskin A, Akdoğan E, Dunn CD (2017) Evidence for amino acid snorkeling from a high-resolution, in vivo analysis of Fis1 tail anchor insertion at the mitochondrial outer membrane. Genetics, 205(2): 691-705. http://dx.doi.org/10.1534/genetics.116.196428

Additionally, please cite the Dryad data package:

Keskin A, Akdoğan E, Dunn CD (2016) Data from: Evidence for amino acid snorkeling from a high-resolution, in vivo analysis of Fis1 tail anchor insertion at the mitochondrial outer membrane. Dryad Digital Repository. http://dx.doi.org/10.5061/dryad.j14r5
Cite | Share
Download the data package citation in the following formats:
   RIS (compatible with EndNote, Reference Manager, ProCite, RefWorks)
   BibTex (compatible with BibDesk, LaTeX)

Search for data

Be part of Dryad

We encourage organizations to: