Data from: Sexual reproduction in Aspergillus flavus sclerotia: acquisition of novel alleles from soil populations and uniparental mitochondrial inheritance

Horn BW, Gell RM, Singh R, Sorensen RB, Carbone I

Date Published: January 6, 2016

DOI: http://dx.doi.org/10.5061/dryad.sk35h

 

Files in this package

Content in the Dryad Digital Repository is offered "as is." By downloading files, you agree to the Dryad Terms of Service. To the extent possible under law, the authors have waived all copyright and related or neighboring rights to this data. CC0 (opens a new window) Open Data (opens a new window)

Title Table 1 Raw Data
Downloaded 26 times
Description Contains the raw data for Table 1. "Sexual reproduction in A. flavus sclerotia from single strains of one mating type when incubated on sterile soil and on soil containing natural fungal populations." Includes number of sclerotia examined and percent fertile sclerotia for each replicate soil cup of each single strain and statistics for comparing the strains.
Download Table 1 Raw Data.xlsx (16.16 Kb)
Details View File Details
Title Table 3 Raw Data
Downloaded 17 times
Description Contains the raw data for Table 3. "Reciprocal crosses in A. flavus in which single-strain sclerotia were incubated on sterilized soil inoculated with conidia." Includes number of sclerotia examined and percent fertile sclerotia for each replicate soil cup of each cross and statistics for comparing the strains.
Download Table 3 Raw Data.xlsx (16.28 Kb)
Details View File Details
Title Table 4 Raw Data
Downloaded 17 times
Description Contains the raw data for Table 4. "Sexual reproduction in A. flavus sclerotia obtained from crosses and incubated under laboratory conditions." Includes number of sclerotia examined and percent fertile sclerotia for each replicate of each single strain and statistics for comparing the strains.
Download Table 4 Raw Data.xlsx (15.90 Kb)
Details View File Details
Title Table 6 Raw Data
Downloaded 20 times
Description Contains the raw data for Table 6. "Soil populations of Aspergillus section Flavi species (CFU/g) in fields prior to application of A. flavus sclerotia.." Includes concentrations (CFU/g) for each species examined from five soil samples taken from Field A, Field B, and Field C and statistics for comparing the concentrations for each field.
Download Table 6 Raw Data.xlsx (13.60 Kb)
Details View File Details
Title Table S1 Raw Data
Downloaded 17 times
Description Contains the raw data for S1 Table. "Weather conditions at three fields (2013-2014) where single-strain and fertilized sclerotia of A. flavus were applied." Includes the daily minimum, maximum, and mean temperature for Field A, Field B, and Field C from August 16th, 2013 til August 15th, 2014. Contains ANOVA results for comparison between the Fields for minimum, maximum, and mean temperatures from each month.
Download Table S1 Raw Data.xlsx (120.2 Kb)
Details View File Details
Title NRRL29537_and_NRRL29536_progeny_AF-MIT-1
Downloaded 13 times
Description Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29537 and NRRL 29536. Corresponds to the primer pair AF-MIT-1 (F: TGAAGCAACTGGATTATTCGCA, R: AAACCACATTCAAAAGCGCT).
Download NRRL29537_and_NRRL29536_progeny_AF-MIT-1.fas (720 bytes)
Details View File Details
Title NRRL29507_and_NRRL21882_progeny_AF-MIT-3
Downloaded 7 times
Description Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29507 and NRRL 21882. Corresponds to the primer pair AF-MIT-3 (F: AGCAGAGGGTTCTGCGTTT, R: GCAGATCAACCTGCTAATAATATTCC).
Download NRRL29507_and_NRRL21882_progeny_AF-MIT-3.fas (6.721 Kb)
Details View File Details
Title NRRL29473_and_AF36_progeny_AF-MIT-4
Downloaded 10 times
Description Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29473 and AF36. Corresponds to the primer pair AF-MIT-4 (F: GCTAAAGTTATAGGAGGTGAAGT, R: GCAACCTTTAGCTTCAATAAACCC).
Download NRRL29473_and_AF36_progeny_AF-MIT-4.fas (3.204 Kb)
Details View File Details

When using this data, please cite the original publication:

Horn BW, Gell RM, Singh R, Sorensen RB, Carbone I (2016) Sexual reproduction in Aspergillus flavus sclerotia: acquisition of novel alleles from soil populations and uniparental mitochondrial inheritance. PLOS ONE 11(1): e0146169. http://dx.doi.org/10.1371/journal.pone.0146169

Additionally, please cite the Dryad data package:

Horn BW, Gell RM, Singh R, Sorensen RB, Carbone I (2016) Data from: Sexual reproduction in Aspergillus flavus sclerotia: acquisition of novel alleles from soil populations and uniparental mitochondrial inheritance. Dryad Digital Repository. http://dx.doi.org/10.5061/dryad.sk35h
Cite | Share
Download the data package citation in the following formats:
   RIS (compatible with EndNote, Reference Manager, ProCite, RefWorks)
   BibTex (compatible with BibDesk, LaTeX)

Search for data

Be part of Dryad

We encourage organizations to: