From hidden hearing loss to supranormal auditory processing by neurotrophin 3-mediated modulation of inner hair cell synapse density

Corfas, Gabriel1 ; Ji, Lingchao1

Published May 08, 2024 on Dryad. https://doi.org/10.5061/dryad.k6djh9w8v

Abstract

Loss of synapses between spiral ganglion neurons and inner hair cells (IHC synaptopathy), leads to an auditory neuropathy called hidden hearing loss (HHL) characterized by normal auditory thresholds but reduced amplitude of sound-evoked auditory potentials. It has been proposed that synaptopathy and HHL result in poor performance in challenging hearing tasks despite a normal audiogram. However, this has only been tested in animals after exposure to noise or ototoxic drugs, which can cause deficits beyond synaptopathy. Furthermore, the impact of supernumerary synapses on auditory processing has not been evaluated. Here, we studied mice in which IHC synapse counts were increased or decreased by altering neurotrophin 3 (Ntf3) expression in IHC-supporting cells. As we previously showed, postnatal Ntf3 knockdown or overexpression reduces or increases, respectively, IHC synapse density and suprathreshold amplitude of sound-evoked auditory potentials without changing cochlear thresholds. We now show that IHC synapse density does not influence the magnitude of the acoustic startle reflex or its prepulse inhibition. In contrast, gap-prepulse inhibition, a behavioral test for auditory temporal processing, is reduced or enhanced according to Ntf3 expression levels. These results indicate that IHC synaptopathy causes temporal processing deficits predicted in HHL. Furthermore, the improvement in temporal acuity achieved by increasing Ntf3 expression and synapse density suggests a therapeutic strategy for improving hearing in noise for individuals with synaptopathy of various etiologies.

README: From hidden hearing loss to supranormal auditory processing by neurotrophin 3-mediated modulation of inner hair cell synapse density

This IHC_2024__DATA_README.doc file was generated on 2024-04-01 by Lingchao Ji

GENERAL INFORMATION

Title of Dataset: Data from: From Hidden Hearing Loss to Supranormal Auditory Processing by Neurotrophin 3-mediated Modulation of Inner Hair Cell Synapse Density.
Author Information

Corresponding Investigator
Name: Dr Gabriel Corfas
Institution: Kresge Hearing Research Institute and Dept. of Otolaryngology, University of Michigan, USA
Email: corfas@med.umich.edu

Co-investigator 1
Name: Dr Lingchao Ji
Institution: Kresge Hearing Research Institute and Dept. of Otolaryngology, University of Michigan, USA

Co-investigator 2
Name: Dr Beatriz C. Borges
Institution: Kresge Hearing Research Institute and Dept. of Otolaryngology, University of Michigan, USA

Co-investigator 3
Name: Dr David T. Martel
Institution: Kresge Hearing Research Institute and Dept. of Otolaryngology, University of Michigan, USA

Co-investigator 4
Name: Dr Calvin Wu
Institution: Kresge Hearing Research Institute and Dept. of Otolaryngology, University of Michigan, USA

Co-investigator 5
Name: Dr M. Charles Liberman
Institution: Mass.Eye and Ear Infirmary and Harvard Medical School, USA

Co-investigator 6
Name: Dr Susan E. Shore
Institution: Kresge Hearing Research Institute and Dept. of Otolaryngology, Biomedical Engineering, Molecular and Integrative Physiology, University of Michigan, USA

3. Date of data collection: 2017-2022

Geographic location of data collection: Ann Arbor, Michigan, USA.
Funding sources that supported the collection of the data: University of Michigan.
Recommended citation for this dataset: Ji, et al. (2024), Data from: From Hidden Hearing Loss to Supranormal Auditory Processing by Neurotrophin 3-mediated Modulation of Inner Hair Cell Synapse Density, Dryad, Dataset.

DATA & FILE OVERVIEW

Description of dataset These data were generated to investigate the impact of cochlear synapse density on auditory function, and to probe the effects of cochlear synaptopathy in the absence of cochlear insults from acoustic overexposure, ototoxic drugs or aging. we used transgenic mice in which IHC synapse density can be controlled via altering neurotrophin 3 (Ntf3) expression by IHC-supporting cell. First, we used DPOAE, ABR, immunostaining and qPCR to verify cochlear synaptopathy in Ntf3 knockdown and clarify the phenotype of Ntf3-overexpresser. Then we tested the auditory behavioral phenotypes of these transgenic mice, focusing on the acoustic startle reflex and its modulation by prepulse inhibition (PPI) and gap-prepulse inhibition of the acoustic startle (GPIAS), to assess sensory gating and auditory temporal processing.
File List:
Folder 1 Name: 1_Synapse data
Folder 1 Description: The images of immunostaining of cochlear IHC synapses in Ntf3 knockdown and Ntf3-overexpresser

Folder 2 Name: 2_DPOAE-ABR data
File 2 Description: The DPOAE and ABR recordings in Ntf3 knockdown and Ntf3-overexpresser

File 1 Name: Fig_2 Data.xlsx
File 1 Description: The impacts of Ntf3 expression levels on TrkC signaling in the cochlea and the CNS

File 2 Name: Fig_3 Data.xlsx
File 2 Description: The regulation of Ntf3 expression on IHC synapse density

File 3 Name: Fig_4 Data.xlsx
File 3 Description: The effects of Ntf3 knockdown or overexpression on cochlear thresholds and ABR peak I amplitudes

File 4 Name: Fig_5 Data.xlsx
File 4 Description: The effects of Ntf3 knockdown or overexpression on ABR amplitude growth functions and ABR peak latencies

File 5 Name: Fig_6 Data.xlsx
File 5 Description: The effects of Ntf3 knockdown or overexpression on ABR peak latencies

File 6 Name: Fig_7 Data.xlsx
File 6: Description: The influence of IHC synapse density on the acoustic startle response and prepulse inhibition

File 7 Name: Fig_8 Data.xlsx
File 7 Description: The influence of Ntf3 expression levels on Gap detection thresholds in broadband noise

File 8 Name: Fig_9 Data.xlsx
File 8 Description: The influence of Ntf3 expression levels on Gap inhibition in narrowband noise

File 9 Name: Fig_S1 Data.xlsx
File 8 Description: Gap inhibition across different test sessions

File 10 Name: Fig_S2 Data.xlsx
File 8 Description: The correlation between gap inhibition and ABR peak I amplitude

METHODOLOGICAL INFORMATION

See Methods Section of the dataset landing page.

DATA-SPECIFIC INFORMATION FOR: 1_Synapse data

Data files: 2
File List: (1) Ntf3-KD images.lif : contains confocal images of IHC synapses from Ntf3-KD and their controls. Open with Fiji, pre-synaptic ribbons are labeled with CtBP2 - red, post-synaptic receptor patches are labeled with GluA2 – green, and hair cells are labeled with Myo7a - blue. Each image represents a specific cochlear region from an individual mouse. (2) Ntf3-OE images.lif: contains confocal images of IHC synapses from Ntf3-OE and their controls. Open with Fiji, pre-synaptic ribbons are labeled with CtBP2 - red, post-synaptic receptor patches are labeled with GluA2 – green, and hair cells are labeled with Myo7a - blue. Each image represents a specific cochlear region from an individual mouse.

DATA-SPECIFIC INFORMATION FOR: 2_DPOAE-ABR data

Data subfolders: 83
Subfolder List: LJ198~LJ638: contains ABR and DPOAE recordings for analysis in Fig_4 Data.xlsx, Fig_5 Data.xlsx and Fig_6 Data.xlsx. Open ABR data using ABR peak-analysis software (https://www.masseyeandear.org/research/otolaryngology/eaton-peabody-laboratories/engineering-core ). Open DPOAE data using Excel. Each subfolder includes recordings from an individual mouse.

DATA-SPECIFIC INFORMATION FOR: Fig_2 Data.xlsx

Data sheets: 5
Sheet List: (1) Fig_2A data: contains mRNA level of Ntf3 and VGF in Ntf3-KD cochleas. Variable List: group: Control; Ntf3-KD id: each individual mouse genotype: PLP1cre ERT (-): NT3fl= Control; PLP1cre ERT (+): NT3fl= Ntf3-KD Mean CT: average cycle threshold value of triplicates (E)^-CT: expression: expression by Delta CT NGE to RPL19: normalized gene expression to RPL19 relative expression: fold change Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (2) Fig_2B data: contains mRNA level of Ntf3 and VGF in Ntf3-OE cochleas. Variable List: group: Control; Ntf3-KD id: each individual mouse genotype: PLP1cre ERT (-): NT3fl= Control; PLP1cre ERT (+): NT3fl= Ntf3-KD Mean CT: average cycle threshold value of triplicates (E)^-CT: expression: expression by Delta CT NGE to RPL19: normalized gene expression to RPL19 relative expression: fold change Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (3) Fig_2C data: contains correlation of cochlear of Ntf3 and VGF mRNA. Variable List: Ntf3: relative expression of Ntf3 in the cochlea VGF: relative expression of VGF in the cochlea Each row represents an individual sample. (4) Fig_2D data: contains mRNA level of Ntf3 and VGF in Ntf3-KD brain. Variable List: group: Control; Ntf3-KD id: each individual mouse genotype: PLP1cre ERT (-): NT3fl= Control; PLP1cre ERT (+): NT3fl= Ntf3-KD Mean CT: average cycle threshold value of triplicates (E)^-CT: expression: expression by Delta CT NGE to RPL19: normalized gene expression to RPL19 relative expression: fold change (5) Fig_2E data: contains mRNA level of Ntf3 and VGF in Ntf3-OE brain. Variable List: group: Control; Ntf3-KD id: each individual mouse genotype: PLP1cre ERT (-): NT3fl= Control; PLP1cre ERT (+): NT3fl= Ntf3-KD Mean CT: average cycle threshold value of triplicates (E)^-CT: expression: expression by Delta CT NGE to RPL19: normalized gene expression to RPL19 relative expression: fold change

DATA-SPECIFIC INFORMATION FOR: Fig_3 Data.xlsx

Data sheets: 6
Sheet List: (1) Fig_3B Data: contains mean counts of pre-synaptic ribbons in Ntf3 KDs and its controls. Variable List: Cochlear region (kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-KD: Ntf3-KD group Control: Control group Each column represents an individual sample. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (2) Fig_3C Data: contains mean counts of post-synaptic receptor patches in Ntf3 KDs and its controls. Variable List: Cochlear region (kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-KD: Ntf3-KD group Control: Control group Each column represents an individual sample. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (3) Fig_3D Data: contains mean counts of ribbon synapses in Ntf3 KDs and its controls. Variable List: Cochlear region (kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-KD: Ntf3-KD group Control: Control group Each column represents an individual sample. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (4) Fig_3F Data: contains mean counts of pre-synaptic ribbons in Ntf3 OEs and its controls. Variable List: Cochlear region (kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-OE: Ntf3-OE group Control: Control group Each column represents an individual sample. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (5) Fig_3G Data: contains mean counts of post-synaptic receptor patches in Ntf3 OEs and its controls. Variable List: Cochlear region (kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-OE: Ntf3-OE group Control: Control group Each column represents an individual sample. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (6) Fig_3H Data: contains mean counts of ribbon synapses in Ntf3 OEs and its controls. Variable List: Cochlear region (kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-OE: Ntf3-OE group Control: Control group Each column represents an individual sample. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated.

DATA-SPECIFIC INFORMATION FOR: Fig_4 Data.xlsx

Data sheets: 6
Table List: (1) Fig_4A Data: contains DPOAE thresholds in Ntf3-KD and its control. Variable List: Frequency(kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-KD: Ntf3-KD group Control: Control group Each column represents an individual mouse. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (2) Fig_4B Data: contains ABR thresholds in Ntf3-KD and its control Variable List: Frequency(kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-KD: Ntf3-KD group Control: Control group Each column represents an individual mouse. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (3) Fig_4C Data: contains ABR peak I amplitudes in Ntf3-KD and its control Variable List: Frequency(kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-KD: Ntf3-KD group Control: Control group Each column represents an individual mouse. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (4) Fig_4D Data: contains DPOAE thresholds in Ntf3-OE and its control Variable List: Frequency(kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-OE: Ntf3-OE group Control: Control group Each column represents an individual mouse. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (5) Fig_4E Data: contains ABR thresholds in Ntf3-OE and its control. Variable List: Frequency(kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-OE: Ntf3-OE group Control: Control group Each column represents an individual mouse. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (6) Fig_4F Data: contains ABR peak I amplitudes in Ntf3-OE and its control. Variable List: Frequency(kHz): 5.6; 8; 11.3; 16; 22.6; 32 Ntf3-OE: Ntf3-OE group Control: Control group Each column represents an individual mouse. Blue text represents mouse id. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated.

DATA-SPECIFIC INFORMATION FOR: Fig_5 Data.xlsx

Data sheets: 2

2.Table List:
(1) Fig_5A Data: contains mean amplitude-vs level functions for ABR peaks I-IV in Ntf3-KD mice and their respective controls at 16 kHz.
Variable List:
Peak: P1, P2, P3, P4, P5
Intensity (dB): 80, 70, 60, 50, 40 ,30, 20, 10
Ntf3-KD: Ntf3-KD group
Control: Control group
id: Blue text represents mouse id.
Each column represents an individual mouse.
Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated.
(2) Fig_5B Data: contains mean amplitude-vs level functions for ABR peaks I-IV in Ntf3-OE mice and their respective controls at 16 kHz.
Variable List:
Peak: P1, P2, P3, P4, P5
Intensity (dB): 80, 70, 60, 50, 40 ,30, 20, 10
Ntf3-OE: Ntf3-OE group
Control: Control group
id: Blue text represents mouse id.
Each column represents an individual mouse.
Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated.

DATA-SPECIFIC INFORMATION FOR: Fig_6 Data.xlsx

Data sheets: 2
Sheet List: (1) Fig_6A Data: contains latencies of ABR peaks I-V of Ntf3-KD and their respective controls at 16 kHz. Variable List: Peak: P1, P2, P3, P4, P5 Intensity (dB): 80, 70, 60, 50, 40 ,30, 20, 10 Ntf3-KD: Ntf3-KD group Control: Control group id: Blue text represents mouse id. Each column represents an individual mouse. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (2) Fig_6B Data: contains latencies of ABR peaks I-V of Ntf3-OE and their respective controls at 16 kHz. Variable List: Peak: P1, P2, P3, P4, P5 Intensity (dB): 80, 70, 60, 50, 40 ,30, 20, 10 Ntf3-OE: Ntf3-OE group Control: Control group id: Blue text represents mouse id. Each column represents an individual mouse. Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated.

DATA-SPECIFIC INFORMATION FOR: Fig_7 Data.xlsx

Data sheets: 7
Sheet List: (1) raw data: contains raw data for analysis in Fig_7A2 Data, Fig_7A3 Data, Fig_7B2 Data, Fig_7B3 Data, Fig_7C2 Data, Fig_7C3 Data. Variable List: Date Id: mouse ID TrialName TrialIndex Max(N): response amplitude to the corresponding trial.\ (2) Fig_7A2 Data: contains response amplitude to prepulse in Ntf3-KD and control mice. Variable List: Ntf3-KD: Ntf3-KD group Control: Control group (3) Fig_7A3 Data: contains response amplitude to prepulse in Ntf3-OE and control mice. Variable List: Ntf3-OE: Ntf3-OE group Control: Control group (4) Fig_7B2 Data: startle amplitudes in Ntf3-KD mice and their control littermates. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-KD: Ntf3-KD group Control: Control group (5) Fig_7B3 Data: startle amplitudes in Ntf3-OE mice and their control littermates. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-KD: Ntf3-OE group Control: Control group (6) Fig_7C2 Data: prepulse inhibition of the startle response by a prepulse in Ntf3-KD mice and their control littermates. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-KD: Ntf3-KD group Control: Control group (7) Fig_7C3 Data: prepulse inhibition of the startle response by a prepulse in Ntf3-OE mice and their control littermates. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-KD: Ntf3-OE group Control: Control group

DATA-SPECIFIC INFORMATION FOR: Fig_8 Data.xlsx

Data sheets: 9
Sheet List: (1) raw data: contains raw data for analysis in Fig_8B Data, Fig_8C Data, Fig_8D Data, Fig_8E Data, Fig_8F Data, Fig_8G Data, Fig_8H Data and Fig_8I Data. Variable List: Date id: mouse ID TrialName Max(N): response amplitude to the corresponding trial.\ (2) Fig_8B Data: ASR amplitudes for the NO-GAP trials in Ntf3 mutant mice and their control littermates. Variable List: Ntf3-KD: Ntf3-KD group Control: Control group id: mouse ID (3) Fig_8C Data: ASR amplitudes for the NO-GAP trials in Ntf3 mutant mice and their control littermates. Variable List: Ntf3-OE: Ntf3-OE group Control: Control group id: mouse ID (4) Fig_8D Data: level of gap inhibition vs. gap length and for Ntf3-KD and control mice. Variable List: Gap length: 3, 5,15,25, 50 Ntf3-KD: Ntf3-KD group Control: Control group Blue text represents mouse id. (5) Fig_8E Data: level of gap inhibition vs. gap length and for Ntf3-OE and control mice. Variable List: Gap length: 3, 5,15,25, 50 Ntf3-OE: Ntf3-OE group Control: Control group Blue text represents mouse id. (6) Fig_8F Data: contains gap detection threshold in Ntf3-KD and control mice. Variable List: Ntf3-KD: Ntf3-KD group Control: Control group id: mouse ID (7) Fig_8G Data: contains gap detection threshold in Ntf3-OE and control mice. Variable List: Ntf3-OE: Ntf3-OE group Control: Control group id: mouse ID (8) Fig_8H Data: contains Rd’ vs. gap length for Ntf3-KD and control mice. Variable List: Gap length: 3, 5,15,25, 50 Ntf3-KD: Ntf3-KD group Control: Control group Blue text represents mouse id. (9) Fig_8I Data: contains Rd’ vs. gap length for Ntf3-OE and control mice Variable List: Gap length: 3, 5,15,25, 50 Ntf3-OE: Ntf3-OE group Control: Control group Blue text represents mouse id.

DATA-SPECIFIC INFORMATION FOR: Fig_9 Data.xlsx

Data sheets: 5
Sheet List: (1) raw data: contains raw data for analysis in Fig_9B Data, Fig_9C Data, Fig_9D Data and Fig_9E Data. Variable List: Date ID: mouse ID TrialName TrialIndex Max(N): response amplitude to the corresponding trial.\ (2) Fig_9B Data: contains responses to startle stimulus in continuous NBN background in Ntf3-KD and control mice. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-KD: Ntf3-KD group Control: Control group Blue text represents mouse id. (3) Fig_9C Data: contains responses to startle stimulus in continuous NBN background in Ntf3-OE and control mice. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-OE: Ntf3-OE group Control: Control group Blue text represents mouse id. (4) Fig_9D Data: contains GPIAS in narrowband noises in Ntf3-KD and control mice. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-KD: Ntf3-KD group Control: Control group Blue text represents mouse id. (5) Fig_9E Data: contains GPIAS in narrowband noises in Ntf3-OE and control mice. Variable List: Frequency (kHz): 8, 12, 16, 24, 40 Ntf3-OE: Ntf3-OE group Control: Control group Blue text represents mouse id.

DATA-SPECIFIC INFORMATION FOR: Fig_S1 Data.xlsx

Data sheets: 5
Sheet List: (1) raw data: contains raw data for analysis in Fig_S1A Data, Fig_S1B Data, Fig_S1C Data and Fig_S1D Data. Variable List: Date ID: mouse ID TrialName Max(N): response amplitude to the corresponding trial.\ (2) Fig_S1A Data: contains gap inhibition vs. gap length across the three timepoints for control of Ntf3-KD mice. Variable List: Gap length: 3, 5,15,25, 50 Timepoints: test-1, test-2, test-3 Blue text represents mouse id. (3) Fig_S1B Data: contains gap inhibition vs. gap length across the three timepoints for Ntf3-KD mice. Variable List: Gap length: 3, 5,15,25, 50 Timepoints: test-1, test-2, test-3 Blue text represents mouse id. (4) Fig_S1C Data: contains gap inhibition vs. gap length across the three timepoints for control of Ntf3-OE mice. Variable List: Gap length: 3, 5,15,25, 50 Timepoints: test-1, test-2, test-3 Blue text represents mouse id. (5) Fig_S1D Data: contains gap inhibition vs. gap length across the three timepoints for Ntf3-OE mice. Variable List: Gap length: 3, 5,15,25, 50 Timepoints: test-1, test-2, test-3 Blue text represents mouse id.

DATA-SPECIFIC INFORMATION FOR: Fig_S2 Data.xlsx

Data sheets: 2
Sheet List: (1) Fig_S2A Data: contains ABR peak I amplitude versus gap inhibitory level of Ntf3-KD and their littermate controls. Variable List: ABR P1 Amplitude Gap Inhibition ID: Blue text represents mouse id. Frequency (kHz): 5.6, 8, 11.3, 16, 22.6, 32, 45.2 kHz for ABR P1 amplitude; 8, 12, 16, 24, 40 kHz for gap inhibition Amplitude average Gap Inhibition Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated. (2) Fig_S2B Data: contains ABR peak I amplitude versus gap inhibitory level of Ntf3-OE and their littermate controls. Variable List: ABR P1 Amplitude Gap Inhibition ID: Blue text represents mouse id. Frequency (kHz): 5.6, 8, 11.3, 16, 22.6, 32, 45.2 kHz for ABR P1 amplitude; 8, 12, 16, 24, 40 kHz for gap inhibition Amplitude average Gap Inhibition Missing data codes: ‘N/A’ indicates the element was too incomplete to be measured or estimated.

Methods

Animals: All experimental procedures complied with the National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the University of Michigan, MI, USA. Cochlear supporting-cell specific Ntf3 knock-down mice (Ntf3 KD) derived from Ntf3^flox/flox:Plp1/CreER^T mice by Cre-recombination) and Ntf3 overexpressing mice (Ntf3 OE derived from Ntf3^stop:Plp1/CreER^T mice by Cre-recombination) were generated. Ntf3 KD mice and their controls were maintained on C57BL/6 background. Ntf3 OE and their controls were on FVB/N background. Both male and female mice were included in this study.

Tamoxifen administration: Tamoxifen was injected into the intraperitoneal cavity of P 3-10 Ntf3^stop: Plp1/CreER^T mice or P1-3 Ntf3^flox/flox:Plp1/CreER^T mice. A 10 mg/ml solution of tamoxifen was obtained by dissolution in corn oil. Injection was 33 mg/kg for Ntf3^stop: Plp1/CreER^T mice and 50 mg/kg for Ntf3^flox/flox:Plp1/CreER^Tmice.

Real-time quantitative RT-PCR: Total RNA was isolated from the cortical brain and cochlea samples from 1-month-old mice using RNA extraction kit and Qiazol Reagent (RNeasy mini kit; Qiagen, Germany), and DNase treatment was performed (RNase-free; Qiagen). The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol. Quantitative RT-PCR was performed on a CFX-96 Bio-Rad reverse transcription polymerase chain reaction detection system (Hercules, CA, USA) using iTaq Universal SYBR® Green supermix (Bio-Rad, # 172-5121, USA) and primer pairs were synthesized by IDT (Coralville, IA, USA). All samples and standard curves were run in triplicate. Water instead of complementary DNA was used as a negative control. The 10 μl reaction contained 5 μl of SYBR Green supermix, 6 pmol of each forward and reverse primer (0.6 μl), 1.9 μl of nuclease-free water, and 2.5 μl of cDNA sample. The mRNA expression levels in PLP1cre ERT: NT3fl or PLP1cre ERT: NT3 STOP versus their control mice were determined by a comparative cycle threshold (Ct) method and relative gene copy number was calculated as normalized gene expression. Ribosomal protein L19 (RPL19) was used as the housekeeping gene. The following specific oligo primers were used for the target genes: Rpl19, F: 5’ACCTGGATGAGAAGGATGAG 3’; R: 5’ACCTTCAGGTACAGGCTGTG 3’; Ntf3, F 5’GCCCCCTCCCTTATACCTAATG 3’; R: 5’CATAGCGTTTCCTCCGTGGT 3’; Vgf: F: 5’GGTAGCTGAGGACGCAGTGT 3’; R: 5’GTCCAGTGCCTGCAACAGT 3’. Changes in mRNA expression were calculated as relative expression (arbitrary units) respective to the control group for each mouse line.

Immunostaining and synaptic counts: Cochleas from 16-week-old mice were prepared for whole-mount imaging. In brief, the samples were fixed with 4% formaldehyde for 2 hours and then decalcified with 5% ethylenediaminetetraacetic acid (EDTA) for 3-5 days. Cochlear epithelia were micro-dissected into five segments for whole-mount processing. The cochlea segments were permeabilized by freeze–thawing in 30% and then blocked with 5% normal horse serum for 1 hour. Afterwards, the following primary antibodies were used: 1) CtBP2 to visualize synaptic ribbons (mouse anti-CtBP2 at 1:200, BD Biosciences, catalog # 612044, RRID: AB_399431), 2) GluR2 to visualize postsynaptic receptors (mouse anti-GluR2 at 1:2000, Millipore, catalog # MAB397, RRID: AB_2113875) and 3) Myosin VIIa to visualize IHCs (rabbit anti-Myosin VIIa at 1:200; Proteus Biosciences, catalog # 25-6790, RRID: AB_10015251). Secondary antibodies used were Alexa Fluor 488 conjugated anti-mouse IgG2a (1:1000, Invitrogen), Alexa Fluor 568 conjugated anti-mouse IgG1 (1:1000, Invitrogen), and Alexa Fluor 647 conjugated anti-rabbit (1:1000, Life Technologies). Frequency maps were created using a custom ImageJ plug-in. Images were captured from 5.6 to 45.2 kHz using a Leica SP8 with a 1.4 NA 63x oil immersion objective at 3 digital zoom. Offline image analysis was performed using Amira (Visage Imaging). Quantifications of synapses were done by a blind investigator.

Distortion Product Otoacoustic Emissions (DPOAE) and Auditory Brainstem Responses (ABR): DPOAEs and ABRs were performed. Mice were anaesthetized by i.p. injections of xylazine (20 mg kg⁻¹, i.p.) and ketamine (100 mg kg⁻¹, i.p.). The DPOAEs were induced by two primary tones (f1 and f2) and recorded at (2 × f1)−f2. f1 level was10 dB higher than the f2 level and frequency ratio f2/f1 was 1.2. The ear-canal sound pressure was amplified and averaged at 4 μs intervals. DPOAE thresholds were defined as the f2 level that produced a response 10 dB SPL higher than the noise floor. For ABR measurement, subdermal electrodes were placed (a) at the dorsal midline of the head, (b) behind the left earlobe, and (c) at the base of the tail (for a ground electrode). ABRs were evoked with 5 ms tone pips (0.5 ms rise–fall) delivered to the eardrum. The frequencies of tone pips were 5.6, 8, 11.3, 16, 22.6, 32, and 45.2 kHz, with 15 sound levels from 10 to 80 dB SPL for each frequency. The signals were amplified 10,000 times and filtered through a 0.3 - 3 kHz passband. At each level, an average of 1,024 signals was taken after ‘artifact rejection’. Both recordings were performed using National Instruments input/output boards hardware. Offline analysis was performed using Excel and ABR peak analysis software.

Pre-pulse inhibition (PPI) and gap inhibition of the acoustic startle (GPIAS): Mice were tested in a 10 x 4.5 x 4 cm cage inside a sound-isolation chamber that were placed within a sound-attenuating room. An acoustic sound source was located in the upper part of this chamber. The piezoelectric motion sensor attached to the cage detected the vertical force of the startle reflex. All ASR, PPI, and GPIAS stimuli and responses were generated and recorded with Kinder Scientific Startle Monitor (Kinder Scientific, Poway, CA).

PPI tests were used for assessing sensorimotor gating on 8-15 old week mice, twice a week, each 2 days apart. PPI tests were conducted quiet. The startle stimuli were BBN bursts at 120 dB SPL, 20 ms in duration, 0.1 ms rise-fall times. The prepulse was a narrow band sound centered at 8, 12, 16, 24, and 40 kHz, 50 ms in duration, with 2-ms rise-fall ramps. The PPI test consisted of prepulse trials and startle-only trials, which were delivered alternatively. In prepulse trials, a prepulse ended 50 ms before the startle stimulus. Startle-only trials were similar to the prepulse trials, but no prepulse was delivered. PPI startle ratio is the ratio of the startle magnitude in prepulse trials over the startle magnitude in startle-only trials.

The GPIAS paradigm has been used for measuring auditory temporal processing. Gap inhibition was assessed on 8-15 old week mice, twice a week, 2 days apart. The testing consists of two types of trials, gap trials, and no-gap trials that were delivered alternatively. In both trials, the startle stimulus was 20 ms BBN at 120 dB with 0.1 ms rise/fall times. The startle was preceded either by gaps with varied durations (3-, 5-, 15-, 25-, or 50-ms long) embedded in BBN or by a 50-ms gap embedded in a narrow bandpass background sound centered at 8, 12, 16, 24, and 40 kHz at 65 dB. For gaps with varied durations, the response was normalized to the longest gap (50 ms) on the presumption that the maximum level of inhibition (100%) was elicited at the longest gap. The responses and gap durations were fitted with three-parameter logistic regression models. The gap-detection threshold was defined as the value of the fitted curve that elicited 50% of the maximal inhibition achieved per mouse. Gap-startle ratio is the ratio of the startle magnitude in gap trials over the startle magnitude of the paired no-gap trials.

For each mouse, PPI and gap-startle ratios were averaged from 11 sessions. Each session of PPI and gap-PPI test included 60 pairs of prepulse and startle-only trials for PPI or gap and no-gap trials for gap detection (5 prepulse or background sound frequencies, 12 pairs for each frequency). The interval between trials was randomly varied between 5 and 15s. Each session began with a 2-min acclimatization period in the cage before startle testing began, and all tests were conducted in darkness. Startle-only trials and no-gap trial amplitudes greater than or equal to mean ± 2.5 standard deviations were eliminated. When a trial was eliminated, its paired trial was also eliminated. PPI ratios bigger than 1 or gap-startle ratios bigger than 1.1 were excluded. PPI and gap-startle ratios were calculated as the average with prepulse startle amplitude divided by the mean without prepulse startle amplitude.

Statistical analyses: Analyses were performed using GraphPad Prism 6 (GraphPad Software Inc., La Jolla, CA) and RStudio packages. Data are shown as the mean and standard error of the mean (S.E.M.). The number of replicates (n) is indicated in the results section and figure legends. No explicit power analysis was used to predetermine sample sizes, but our sample sizes are similar to those reported in our previous publications. Statistical differences in auditory physiology (DPOAE threshold, ABR threshold, amplitude, and latency), ribbon synapse counts, behavioral background movement, PPI ratio, gap-startle ratios were analyzed using two-way ANOVA, followed by Bonferroni multiple comparisons test. mRNA expression, ASR amplitude, and gap detection threshold were compared using an unpaired Student’s t-test. Correlations were computed using Pearson’s correlation. The statistical threshold was set to alpha = 0.05.