This README.txt file was generated on 2021-03-23 by Edwin Siu GENERAL INFORMATION 1. Title of Dataset: An Unanticipated Role for Sphingosine Kinase-2 in Bone and in the Anabolic Effect of Parathyroid Hormone (Supplemental Figures) 2. Author Information A. Principal Investigator Contact Information Name: Insogna, Karl Institution: Yale University Address: 333 Cedar St. New Haven, Connecticut, 06520, United States Email: karl.insogna@yale.edu B. Associate or Co-investigator Contact Information Name: Siu, Edwin Institution: Yale University Address: 333 Cedar St. New Haven, Connecticut, 06520, United States Email: edwin.siu@yale.edu 3. Date of data collection: 2017 to 2020 4. Geographic location of data collection: New Haven, Connecticut, United States 5. Information about funding sources that supported the collection of the data: National Institute of Arthritis and Musculoskeletal and Skin Diseases, Award: AR060322 SHARING/ACCESS INFORMATION 1. Licenses/restrictions placed on the data: To the extent possible under law, the authors have waived all copyright and related or neighboring rights to this dataset, titled, An Unanticipated Role for Sphingosine Kinase-2 in Bone and in the Anabolic Effect of Parathyroid Hormone (Supplemental Figures). This work is published from the United States under CC0 Public Domain, https://creativecommons.org/publicdomain/zero/1.0/ 2. Recommended citation for this dataset: Walker, Joanne et al. (2021), An Unanticipated Role for Sphingosine Kinase-2 in Bone and in the Anabolic Effect of Parathyroid Hormone (Supplemental Figures), Dryad, Dataset, https://doi.org/10.5061/dryad.msbcc2fw6 DATA & FILE OVERVIEW 1. File List: DataTableForFigS1.csv DataTableForFigS2.csv FigS1.tif FigS2.tif 2. Files were created on 2021-02-11 and were last updated on 2021-03-23 METHODOLOGICAL INFORMATION These data contain suppplemental figures associated with the following published research article: Walker, Joanne et al. (2021), An Unanticipated Role for Sphingosine Kinase-2 in Bone and in the Anabolic Effect of Parathyroid Hormone, Endocrinology, https://doi.org/10.1210/endocr/bqab042 Micro-CT: Mice in which SPHK1 was selectively deleted in osteoclasts (SPHK1-OC-/-) mice were generated by crossing cathepsin Kcre+/ mice with SPHK1flox/flox mice and then back crossing their cre+ offspring to the SPHK1flox/flox mice followed by appropriate genotyping. SPHK1flox/flox littermates lacking Cathepsin Kcre+/ matched for sex and weight were used controls. Femurs and spines were collected, femurs were stripped of soft tissue and both femur and spine were stored in 70% ethanol at 4 °C for subsequent microcomputed tomographic analyses (μCT). Data were acquired using a Scanco μCT-35 instrument (Scanco, Brutissellen, Switzerland) as previously described (13). Briefly, volumetric regions for trabecular analyses, selected within the endosteal borders of the distal femoral metaphysis to include the secondary spongiosa located 1 mm from the growth plate and extending 1 mm proximally, were scanned at 12 μm resolution. Cortical morphometry was quantified and averaged volumetrically through 50 serial cross-sections (600 μm) extending distally from the diaphyseal mid-point between proximal and distal growth plates. We used a customized thresholding technique (Scanco, Brutissellen, Switzerland) that provided the best segmentation of the bone tissue. Both 2- and 3-D μCT data included bone volume to total volume fraction (BV/TV), trabecular number (Tb.N), thickness (Tb.Th), spacing (Tb.Sp), and connectivity density (Conn.D). Cortical thickness averaged for both cortices (Cor.Th) was also quantified. PTH-induced changes in sCSF1 in SPHK2-/-‑ animals: Twenty SPHK2-/- animals were treated with either vehicle (n=10) or (1-34)hPTH (n=10) for 3 days with single daily injections of either vehicle or 80ng/g-bw h(1-34)PTH. At the end of the 3-day treatment, cortical bone was isolated as described above and expression of sCSF1 quantified using isoform-specific primers: F: ccaagaactgcaacaacagc; R: gggtggctttagggtacagg Statistical Analyses: Statistical analyses were performed using GraphPad Prism version 5.0c (GraphPad Software Inc., San Diego, CA, USA). Two-tailed t tests were used where appropriate. A p value <0.05 was considered significant. Data are presented using bar graphs with standard errors of the mean. DATA-SPECIFIC INFORMATION FOR: FigS1.tif and DataTableForFigS1.csv Figure S1. Baseline BMD Data in SPHK1-Oc-/-. In these 12 week-old male and female SPHK1-Oc-/- animals there were no significant differences in any trabecular bone parameters in the femur, spine and cortical bone compared to controls. (Female control n=9, SPHK1-Oc-/- n=9, male control n=3, SPHK1-Oc-/- n=7, NS=Not Significant) DATA-SPECIFIC INFORMATION FOR: FigS2.tif and DataTableForFigS2.csv Figure S2. An anabolic PTH regimen induces expression of the soluble isoform of CSF1 in cortical bone of SPHK2-/- mice. Cortical bone was isolated from animals at the end of the anabolic PTH treatment regimen as described in the Results. Cortical bone RNA was prepared as described in the Methods and expression of the soluble isoform of CSF1 (sCSF1) was quantified by qPCR using the primers described in the Methods. PTH treatment induced significant expression of the soluble isoform of CSF1 in bone isolated from SPHK2-/- mice. All groups, n=10. ** p<0.01; unless labelled with an asterisk, the differences observed were not significant.