Neurons in the caudal ventral lateral medulla mediate descending pain control

Gu, Xinglong1 ; Zhang, Yizhen1 ; O’Malley, John J.2; De Preter, Caitlynn C.1 ; Penzo, Mario2 ; Hoon, Mark1

Published Nov 28, 2023 on Dryad. https://doi.org/10.5061/dryad.kkwh70s82

Abstract

Supraspinal brain regions modify nociceptive signals in response to various stressors including stimuli which elevate pain thresholds. The medulla oblongata has previously been implicated in this type of pain control, but the neurons and molecular circuits involved have remained elusive. Here we identify catecholaminergic neurons in the caudal ventrolateral medulla that are activated by noxious stimuli in mice. Upon activation, these neurons produce bilateral feed-forward inhibition that attenuates nociceptive responses through a pathway involving the locus coeruleus and noradrenalin in the spinal cord. This pathway is sufficient to attenuate injury-induced heat allodynia and is required for counter-stimulus induced analgesia to noxious heat. Our findings define a component of the pain modulatory system that regulates nociceptive responses.

README: Neurons in the caudal ventral lateral medulla mediate descending pain control

https://doi.org/10.5061/dryad.kkwh70s82

We identify catecholaminergic neurons in the caudal ventrolateral medulla that are activated by noxious stimuli in mice. With fiber photometry, optogenetics and animal behavior, we demonstrated that these neurons produce bilateral feed-forward inhibition that attenuates nociceptive responses through a pathway involving the locus coeruleus and norepinephrine in the spinal cord upon activation.

Description of the data and file structure

Data are the source data for figures and images published in the following paper. Gu, X., Zhang, Y.Z., O’Malley, J.J. et al. Neurons in the caudal ventrolateral medulla mediate descending pain control. Nat Neurosci 26, 594–605 (2023). https://doi.org/10.1038/s41593-023-01268-w
Source data for bar graphs were organized in the excel files. Data in “*.xlsx” for each figure were named accordingly. For panels in each figure, the data are in the sheets of the excel file named accordingly. For example, the data for Figure 1 panel C(Figure 1C) can be found in sheet “Fig1C” in “Figure1.xlsx” file.
In the behavior test data, columns are repeated measures. Each row represents data from one mouse. Five repeated measurements for both left (L) and right (R) hindpaw (for Hargreaves test and cold plantar). L: left hindpaw; R: right hindpaw; Veh: Vehicle; CNO: Clozapine N-oxide (a synthetic ligand for human muscarinic engineered receptors, designer receptors activated by designer drugs or DREADD). Veh L: Left hindpaw measurements after Vehicle injection. Veh R: Right hindpaw measurements after Vehicle injection. CNO L: Left hindpaw measurements after CNO injection. CNO R: Right hindpaw measurements after CNO injection.
In feeding experiments, each column represents data from one mouse.
In slice GCaMP7s (synthetic fusion of green fluorescent protein (GFP) and calmodulin (CaM), genetically encoded calcium indicator) experiments, data from individual cell were presented. Cells were from three animals.
For quantification of images, + and - in the spreadsheets refers to the presence or absence of detectable fluorescent signal from immunostaining.
In in vivo fiber photometry experiments, each time point (first column of the data sheet, each time point represents 5 seconds) represents average GCaMP6s signals in five seconds. Each column represents response from one animal.

Figure 1.The cVLM^TH, a brainstem nucleus activated by capsaicin.

Figure1.xlsx includes the data in figure 1c,d,f and h

Sheet”Fig1C_cfos_CAP+PBS”: Quantification of the percentage of c-Fos⁺TH⁺ to TH+ neurons after capsaicin (CAP) or PBS (Phosphate-buffered saline) injection to the hind paw. Ipsi-capsaicin, Contra-capsaicin: ipsilateral or contralateral cLVM to capsaicin injected hindpaw respectively. Ipsi-PBS, Contra-PBS: ipsilateral or contralateral cLVM to PBS (work as a control) injected hindpaw respectively. TH⁺: Tyrosine hydroxylase immunostaining positive. cLVM: caudal ventral medulla; c-Fos⁺: c-Fos (marker of neuronal activity) immunostaining positive.
Sheet ”Fig1D_cfos_ATP”: Quantification of the percentage of c-Fos⁺TH⁺ to TH⁺ neurons after ATP or PBS to the hindpaw. Ipsi-ATP, Contra-ATP: ipsilateral or contralateral cLVM to ATP (adenosine triphosphate) injected hindpaw. Ipsi-PBS, Contra-PBS: ipsilateral or contralateral cLVM to PBS (work as a control) injected hindpaw respectively.
Sheet ”Fig1F_vGlut2_vGat_insitu”: Quantification of the expression of Vglut2 (vesicular glutamate transporter) and Vgat (Slc32a1, vesicular inhibitory amino acid transporter) in TH neurons with RNAscope in situ hybridization. TH⁺vGlut2⁺^:percentage of vGlut2⁺ vs TH⁺; TH⁺vGAT⁺^:percentage of vGAT⁺ vs TH⁺.
Sheet” Fig1H_AAV-cre_Ai9, #of tdT+”: Quantification of labeled anterograde neurons with anterograde transfer of AAV1 to VLM^TH neurons. Data are the numbers of neurons in each mouse. tdTomato⁺: number of tdTomato positive neurons. TH⁺: number of TH⁺ neurons. TH⁺/tdTomato⁺: number of TH and tdTomato positive neurons.

Figure 2: cVLM^TH neurons are activated by noxious stimuli.

Figure2.xlsx: includes the data in figure 2b-f.

Sheet”Fig2B-Gcamps_CAPinjection”: Averaged in vivo fiber photometry results from cVLM^TH neurons upon stimulation with capsaicin and PBS. CAP: Capsaicin injection into the hindpaw; PBS: PBS injection into the hindpaw. The first column represents the time points (each time points represents 5 seconds) for the measurements. Each column represents data from one animal (numbers are animal ID). Each data point represents averaged fluorescence signal in 5 seconds. CAP or PBS were injected at 15 mins (data point 181 for each mouse). Each data point represents averaged fluorescence signal in 5 seconds.
Sheet”Fig2C_AUC”: Area under the curve (AUC) quantification showed that capsaicin treatment significantly altered calcium responses compared to PBS-injected controls. Summary of the area under the curve from 15 mins (Capsaicin: capsaicin injection) to 45 mins (30 mins after capsaicin injection, from data point 182 to 542). Capsaicin: data from Capsaicin injection. PBS: data from PBS injection.
Sheet”Fig2D_Gcamp6s_temp_ramp25-55”: Responses to heat challenge on a hot plate. GCaMP6s: animals with AAV-flex-GCaMP6s virus; GFP: animals with AAV-flex-GFP virus as control for GCaMP6s. Each column represents data from one animal (numbers are animal ID). GCaMP6s-AUC/GFP-AUC: Summary of the area under the curve from 3 mins (temperature ramp start at 25^oC) to 6 mins (temperature ramp stop at 55^oC) from animals with AAV-flex-GCaMP6s or AAV-flex-GFP.
Sheet”Fig2E_temp_ramp_25-55_heatmap”: Heat map traces from six individual animals to heat challenge and for comparison changes in fluorescence observed in cVLM^TH neurons expressing GFP-expressing control animals. Same data set in Fig2D, but plotted heatmap to show the data from six individual animals. GCaMP6s: animals with AAV-flex-GCaMP6s virus; GFP: animals with AAV-flex-GFP virus as control for GCaMP6s.
Sheet” Fig2F_Gcamp6s_tailbulldog”: Calcium responses to bulldog clamp on the tail. Similar to Fig2D. Bulldog was applied at 3 mins. GCaMP6s: animals with AAV-flex-GCaMP6s virus; GFP: animals with AAV-flex-GFP virus as control for GCaMP6s. Each column represents data from one animal (numbers are animal ID). GCaMP6s-AUC/GFP-AUC: Summary of the area under the curve from 3 mins to 4 mins from animals with AAV-flex-GCaMP6s or AAV-flex-GFP.

Figure 3: VLM^TH neurons potently control nociceptive behavioral responses.

Figure3.xlsx: includes the data in figure 3d, 3f, 3g-l.

Sheet”Fig3D_DREADDq expression”: Quantification of the percentage of cVLM^TH neurons expressing DREADDq-mCherry in the cVLM. Each row represents one animal.
Sheet” Fig3F_cfos_DREADDq_CNO”: Quantification of the percentage of TH neurons expressing c-Fos. Animal were injected with intraperteal injection (i.p.) CNO (CNO) or Vehicle (Veh) solution. Each row represents one animal.
Sheet” Fig3G_Hargreaves test_DREADDq”: Withdrawal latencies (in seconds) in Hargreaves tests with CNO or Vehicle (L and R indicate left and right hindpaw, respectively in all behavior data). Each row represents one animal (in all behavior data). Five repeated measurements for each hindpaw (for Hargreaves test and cold plantar). M: male mouse; F: female mouse. ADD). Veh L: Left hindpaw measurements after Vehicle injection. Veh R: Right hindpaw measurements after Vehicle injection. CNO L: Left hindpaw measurements after CNO injection. CNO R: Right hindpaw measurements after CNO injection.
Sheet” Fig3H_leftside vs rightside”: Withdrawal latencies (in seconds) in Hargreaves tests for chemogenetic activation of cVLM^TH neurons (CNO administration) comparing left versus right cVLM injection. Veh L R: Left hindpaw measurements with virus injection in the right side of the cVLM after Vehicle injection. Veh R R: Right hindpaw measurements with virus injection in the right side of the cVLM after Vehicle injection. Veh L L: Left hindpaw measurements with virus injection in the left side of the cVLM after Vehicle injection. Veh R L: Right hindpaw measurements with virus injection in the left side of the cVLM after Vehicle injection. The column titles apply to measurements after CNO injection.
Sheet” Fig3I_hotpate for DREADDq”: Latency to lick (in seconds) on the hot plate test (52 °C) with CNO or vehicle (Veh) injection.
Sheet”Fig3k_DREADDi”: Withdrawal latencies (in seconds) in Hargreaves tests with CNO or Vehicle in animals expressing DREADDi. DREADDi: Designer Receptors Exclusively Activated by Designer Drugs coupled to Gi (inhibition upon CNO application). Veh L/R: Left/right hindpaw measurements after Vehicle injection. CNO L/R: Left/right hindpaw measurements after CNO injection.
Sheet”Fig3l_DTA”: Withdrawal latencies (in seconds) in Hargreaves tests with CNO or Vehicle in animals expressing DTA (diphtheria toxin subunit A ). Pre-Tam L/R: Left/right hindpaw measurements before tamoxifen treatments (without DTA expression, work as baseline control); Post-Tam L/R; Left/right hindpaw measurements two weeks after tamoxifen treatments (after DTA expression).

Figure 4: Optogenetic stimulation of cVLM^TH triggers extended suppression of nociceptive responses.

Figure4.xlxs: includes the data in figure 4b-d

Sheet “Fig4b_control_optic”: Withdrawal latencies (in seconds) in Hargreaves tests with optogenetic stimulation. AAV2-DIO-GFP virus was injected into cVLM of TH-Cre mice as control. Light OFF L/R: left/right hindpaw without optogenetic stimulation (as control); Light ON L/R; left/right hindpaw with 20Hz optogenetic stimulation.
Sheet “Fig4c_Chr2_optic”: Withdrawal latencies (in seconds) in Hargreaves tests in animals with AAV2-DIO-ChR2-EYFP injection. Light OFF L/R: left/right hindpaw without optogenetic stimulation (as control); Light ON L/R; left/right hindpaw with 20Hz optogenetic stimulation.
Sheet “Fig4d_ChR2_time course”: Withdrawal latencies (in seconds) in Hargreaves tests. Baseline: measurements without optical stimulation (as control); 0 min (during stimulation); measurements during 20Hz optical stimulation; 2/5/10/20/30 min; 2/5/10/20/30 mins after 20Hz optogenetic stimulation.

Figure 5:A descending antinociceptive cVLM–LC–SC circuit.

Figure5.xlxs: includes the data in figure 5f, 5j-k, 5m-n

Sheet”Fig5f_cfos in LC”: Quantification of numbers of LC (locus ceruleus) neurons projecting to the SC (GFP⁺TH⁺) that were c-Fos positive (c-Fos⁺GFP⁺TH⁺) with CNO or Vehicle (Veh) in mice with DREADDq expressed in cLVM.
Sheet”Fig5J_cLVM_Chrimson_LC_GCaMP6s”: Measurements of calcium responses in LC neurons using in vivo fiber photometry. cLVM-Chrimson: data from mice with cVLM^TH neurons expressing ChrimsonR-tdTomato. mCherry: data from control animals with cVLM^TH neurons expressing mCherry. Each column represents average data from one animal.
Sheet”Fig5M_ChrimsonChR2 LVM_stimLC”: Withdrawal latencies (in seconds) in Hargreaves tests with optogenetic stimulation of Chrimson in LC terminals. Light OFF L/R: measurements of left/right hindpaw without optical stimulation (as control); Light ON L/R: measurements of left/right hindpaw with 20Hz optogenetic stimulation. Each row represents five repeated measurements from one animal.
Sheet”Fig5N_mCherryLVM_stimLC”: Control experiments similar to Figure5M. Optogenetic stimulation of LC terminals expressing mCherry. Light OFF L/R: measurements of left/right hindpaw without optical stimulation (as control); Light ON L/R: measurements of left/right hindpaw with 20Hz optogenetic stimulation. Each row represents five repeated measurements from one animal.

Figure 6: cVLM^TH neurons form monosynaptic inputs in the LC.

Figure6.xlxs: includes the data in figure 6c, 6e

Sheet”Fig6c_LC slice GCaMP6s”: average intensity peak of jGCaMP7s fluorescence relative to baseline fluorescence from cells in the ventral LC. Individual neurons data from three mice were included. ACSF: Baseline; TTX: TTX was applied in ACSF; TTX+4AP: TTX and 4AP were applied in ACSF.
Sheet” Fig6e_LC slice dorsal ventral” : Quantification of the averaged intensity peaks of GCaMP7s fluorescence relative to baseline fluorescence for cells located in the ventral or dorsal LC. vLC: measurements for cells from ventral LC; dLC: measurements for cells from dorsal LC.

Figure 7: Antinociceptive and pro-nociceptive responses induced by cVLM^TH neurons are mediated via noradrenergic mediated processes.

Figure7.xlxs: includes the data in figure 7b, 7e, 7f, 7h,

Sheet”Fig7b_Yohimbine“: Withdrawal latencies in Hargreaves tests in mice expressing DREADDq in cLVM with intrathecal (i.t.) administration of yohimbine. Yohimbine L/R: Left/right hindpaw measurements with i.t. injection of Yohimbine. CNO + Yohimbine L/R: Left/right hindpaw measurements with i.p. injection of CNO and i.t. injection of Yohimbine.
Sheet"Fig7E_cLVMDREADDq_LCTHgRNA": Withdrawal latencies in Hargreaves test in mice expressing DREADDq in cLVM and expressing TH guild RNA(gRNA, AAV9-CMV-FLEX-SaCas9-U6-sgRNA-TH) or control (GFP) in LC. Each row represents one animal with GFP(mouseID-GFP) and or animal with gRNA (mouseID-gRNA).
Sheet"Fig7f_THgRNA_hoteplate": The latency to lick (in seconds) on the hot plate test (52 °C) with CNO or PBS (vehicle) in mice expressing TH guild RNA(gRNA) or control (GFP). Each row represent one animal. Veh/CNO-GFP: measurements from mice expressing GFP after vehicle or CNO injection. Veh/CNO-gRNA: measurements from mice expressing gRNA after vehicle or CNO injection.
Sheet"Fig7h_DREADDi_cloidine": Withdrawal latencies in Hargreaves test in mice expressing DREADDi in cLVM with intrathecal (i.t.) administration of clonidine. Clonidine L/R: Left/right hindpaw measurements with i.t. injection of Clonidine. CNO + Clonidine L/R: Left/right hindpaw measurements with i.p. injection of CNO and i.t. injection of Clonidine.

Figure 8: The cVLM circuit is required and sufficient for counter-stimulus-induced analgesia.

Figure8.xlxs: includes the data in figure 8a, 8d, 8e, 8g and 8i-j.

Sheet”Fig8a_DREADDq_CFA”: Withdrawal latencies in Hargreaves test in mice expressing DREADDq after inflammation. Untreated Basline/CNO: measurements before Freund's adjuvant (CFA) injection into the hind plantar with vehicle or CNO injection; CFA treated: measurements after CFA injection into the hind plantar with vehicle injection; CFA treated + CNO: measurements after CFA injection into the hind plantar with CNO injection.
Sheet”Fig8d_cLVMGCaMP6s_forepaw_CAP”: Averaged responses over trials before and after counter-stimulation after subtraction of baselines in fiber photometry experiments. Each column represents data from one animal at different time point. Each data points represent averaged response in five seconds. Heat ramp starts at 3 min and end at 6 min. Capsaicin was injection after first heat ramp and recording resume 1 hour after Capsaicin injection.
Sheet”Fig8e_AUC”: Quantification of AUC for responses to heat ramps. Before Capsaicin: area under the curve from 3 min to 6 min before Capsaicin injection; After Capsaicin: area under the curve from 3 min to 6 min of the second heat ramp 1 hr after Capsaicin injection.
Sheet”Fig8g_WT_DNIC”: Latencies for withdrawal of the ipsilateral paw were significantly changed compared to baseline after the mild burn and were significantly increased compared to mild burn after administration of counter-stimulus in wild type mice. baseline ipsi: measurements from ipsilateral hind paw before mild burn; 24 hrs after Mild Burn ipsi: measurements from ipsilateral hind paw 24 hours after mild burn; 1 hr after forepaw Capsaicin ipsi: measurements from ipsilateral hind paw 1 hour after Capsaicin injection into ipsilateral forepaw with 24-hr mild burn.
Sheet”Fig8I_DNIC_THcreDREADDi”: Latencies for withdrawal of the ipsilateral paw were significantly changed compared to baseline after the mild burn and were significantly increased compared to mild burn after administration of counter-stimulus in mice expressing DREADDi in cVLM^TH neurons. baseline ipsi: measurements from ipsilateral hind paw before mild burn; 24 hrs after Mild Burn ipsi: measurements from ipsilateral hind paw 24 hours after mild burn; 1 hr after forepaw Capsaicin ipsi: measurements from ipsilateral hind paw 1 hour after Capsaicin and CNO injection into ipsilateral forepaw with 24-hr mild burn.
Sheet”Fig8j_DREADDi_2-DG”: Hargreaves withdrawal responses after 2-DG treatment compared to baseline. 2-DG L/R: measurements from left/right hindpaw with i.p. injection of 2-DG; CNO + 2-DG L/R; measurements from left/right hindpaw with i.p. injection of 2-DG and CNO.

Extended Data Fig. 1 cVLM^TH-neurons are catecholaminergic

sFig1.xlxs: includes the data in Extended Data Fig. 1b, 1d, 1e.

Sheet”sFig1b_cfos_TRPV1-KO”: Quantification of cfos expression in TH-neurons. Ipsi-WT: ipsilateral side of Wild-type mouse hindbrain with Capsaicin in hindpaw; Contra-WT; contralateral side of Wild-type mouse hindbrain with Capsaicin in hindpaw; Ipsi-TRPV1KO: ipsilateral side of TRPV1 knockout mouse hindbrain with Capsaicin in hindpaw; Contra-TRPV1KO; contralateral side of TRPV1 knockout mouse hindbrain with Capsaicin in hindpaw.
Sheet”sFig1DE.Vmat,PNMT”: Multilabel ISH of cVLM^TH neurons revealed that the majority of these neurons express monoamine transporter Vmat (Slc18a2) but not adrenaline synthesizing enzyme PNMT. TH⁺vMAT⁺: percentage of vMAT⁺ neurons that are TH⁺; TH⁺PNMT⁺: percentage of PNMT⁺ neurons that are TH⁺. TH⁺DDC⁺: percentage of DDC⁺ neurons that are TH⁺. TH⁺DBH⁺: percentage of DBH⁺ neurons that are TH⁺. tot_th: total number of TH⁺ neurons; th_vmat: number of vMAT⁺ neurons that are TH⁺. th_pnmt: number of pnmt⁺ neurons that are TH⁺. th_ddc: number of DDC⁺ neurons that are TH⁺. th_DBH: number of dbh⁺ neurons that are TH⁺.

Extended Data Fig. 2 Photometry of cVLM^TH-neurons to mild somatosensory stimuli.

sFigure2.xlxs: includes the data in Extended Data Fig. 2b-e

Sheet “sFig2b_Gcamp6s_PAW brush”: Averaged intracellular calcium responses, using in vivo fiber photometry, of cVLM^TH neurons. Responses to mild mechanical with brush to hind-paw. Each column represent one animal (first 5 columns). Each time point (each cell in the column) is the averaged response in 5 seconds. Baseline(12): area under the curve from 5s-baseline; Stimuli(13): area under the curve from 5s after start of brush.
Sheet “sFig2c_cLVM_Gcamps6s_Vonfrey1.4”: Averaged intracellular calcium responses, using in vivo fiber photometry, of cVLM^TH neurons. Responses to von Frey filament on plantar surface of hind-paw. Each column represent one animal (first 6 columns). Each time point are averaged response in 5 seconds. Baseline(11): area under the curve from 5s-baseline; Stimuli(12):area under the curve from 5s after start of von frey filament stimulation.
Sheet “sFig2d_cLVM_Gcamps6s_hargreaves”: Averaged intracellular calcium responses, using in vivo fiber photometry, of cVLM^TH neurons. Responses to localized heating (Hargreaves test on plantar surface of hind-paw). Each column represent one animal (first 6 columns).. Each time point are averaged response in 5 seconds. Baseline(13-14): area under the curve from 10s-baseline; Stimuli(15-16): area under the curve from 10s after start of localized heating.
Sheet “sFig2e_cLVM_GCaMP6s_cold 30.5-0”: Averaged intracellular calcium responses, using in vivo fiber photometry, of cVLM^TH neurons. Responses to cold plate stimulation. Each column represent one animal (first 6 columns). baseline 3 min(3-39): area under the curve from 3 min-baseline; stimuli 3min (40-75): area under the curve from 3 min during cold plate stimulation.

Extended Data Fig. 3 Control chemogenetic activation and inhibition of cVLM^TH-neurons.

sFigure3.xlxs: includes the data in Extended Data Fig. 3a-e

Sheet"remove error": blank sheet for removing format error in other sheets.
Sheet”sFig3a_cLVM_THCreER_CNO GFP con”: Injection of AAV22-hSyn-DIO -GFP into TH-CreER mice did not alter CNO evoked behavioral responses in Hargreaves tests. Veh L: Left hindpaw measurements after Vehicle injection. Veh R: Right hindpaw measurements after Vehicle injection. CNO L: Left hindpaw measurements after CNO injection. CNO R: Right hindpaw measurements after CNO injection.
Sheet”sFig3b_DREADDq hargreaves MvsF”: For both male and female mice, withdrawal latencies were significantly increased, in Hargreaves tests. Baseline/CNO L/R F/M: Left(L)/right(R) hindpaw measurements after Vehicle(baseline) or CNO injection in female(F) or male(M) mice.
Sheet”sFig3c_pre-post tamoxifen”: Hargreaves test responses of mice before and after administration of tamoxifen. Pre-tamoxifen baseline L/R: Left/right hindpaw measurements before administration of tamoxifen; Post-tamoxifen baseline L/R: Left/right hindpaw measurements two weeks after administration of tamoxifen.
Sheet”sFig3d_DREADDi_hargreaves MvsF”: For both male and female mice withdrawal latencies were significantly decreased, in Hargreaves tests, after chemogenetic inhibition of cVLM^TH neurons (CNO administration) compared to saline injected mice. Post-tamoxifen baseline/CNO M/F L/R: Post-tamoxifen: measurements after administration of tamoxifen. baseline/CNO: measurements after vehicle or CNO injection. L/R: Left/right hindpaw, M/F: male/female.
Sheet”sFig3e_DREADDi pre-post tamoxif”: Hargreaves test responses of mice before and after administration of tamoxifen after chemogenetic inhibition. Pre-tamoxifen/post-tamoxifen baseline L/R: Left/right hindpaw measurements before/after administration of tamoxifen.

Extended Data Fig. 4 Effects of chemogenetic activation of cVLM^TH-neurons on itch, touch, cold, motor co-ordination and body temperature.

sFigure4.xlxs: includes the data in Extended Data Fig. 4a-f

Sheet”sFig4a_dreaddq-itch”: Number of scratching bouts over 30 minutes to intradermal injection of chloroquine (200 µg) in the nape of the neck. Vehicle: Veh: Number of scratching bouts after Vehicle injection. CNO: Number of scratching bouts after CNO injection.
Sheet”sFig4b_dreaddq-von frey”: Threshold responses to von Frey filament stimulation was not significantly different between treatment groups (±CNO). Veh L: Left hindpaw measurements after Vehicle injection. Veh R: Right hindpaw measurements after Vehicle injection. CNO L: Left hindpaw measurements after CNO injection. CNO R: Right hindpaw measurements after CNO injection.
Sheet”sFig4c_dreaddq-randal selittos”: Latencies for withdrawal to mechanical pinch responses (Randal Selitto method). Veh: Number of seconds to mechanical pinch responses after Vehicle injection. CNO: Number of seconds to mechanical pinch responses after CNO injection. Each row represents data from one animal with three repeated measurements.
Sheet”sFig4d_dreaddq-cold plantar”: Latencies for withdrawal in plantar reflex responses to cold stimulation. Veh L: Left hindpaw measurements after Vehicle injection. Veh R: Right hindpaw measurements after Vehicle injection. CNO L: Left hindpaw measurements after CNO injection. CNO R: Right hindpaw measurements after CNO injection.
Sheet”sFig4e_dreaddq-rotar rod”: Motor coordination measurements on rotar rod test. Veh/CNO Light On: measurements during light on in the room after Vehicle/CNO injection. Veh/CNO Light OFF: measurements during light off in the room after Vehicle/CNO injection. Each row represents data from one animal with three repeated measurements.
Sheet”sFig4f_dreaddq-corebody temp”: Core body temperature measured with a rectal thermal probe. Veh: temperature after Vehicle injection. CNO: temperature after CNO injection.

Extended Data Fig. 5 Effects of chemogenetic inhibition of cVLM^TH-neurons on itch, touch, cold, motor co-ordination and body temperature.

sFigure5.xlxs: includes the data in Extended Data Fig. 5a-f

Analysis of behavioral responses in TH-CreER mice injected unilaterally in the cVLM with AAV2-hSyn-DIO-hM4D(Gi)-mCherry and tested in behavioral assays following chemogenetic inhibition of cVLM^TH neurons (CNO).
Data were organized the same way in sFgiure4.
#Sheet”sFig5a_dreaddi-itch”:
#Sheet”sFig5b_dreaddi-von frey”:
#Sheet”sFig5c_dreaddi-radal sellito”:
#Sheet”sFig5d_dreaddi-cold plantar”:
#Sheet”sFig5e_dreaddi-rotar rod”:
#Sheet”sFig5f_dreaddi-core bodytemp”:

Extended Data Fig. 8 cVLM^TH-neurons trigger PVT dependent food-seeking but not analgesia.

sFigure8.xlxs: includes the data in Extended Data Fig. 8a-d, 8f-g

Sheet”sFig8a&b”: Feeding behavior was measured during optogenetic stimulation of VLM terminals in either the LC or in the PVT. Food intake was quantified in well-fed mice prior to, during and after light stimulation (30 min, pre-test, stimulation and post-test). The stimulation protocol consisted of 30 mins in which light stimulation alternated between 1 min ‘light ON’ (20 Hz) and 2 min ‘light OFF’ bouts. Each column presents data from one animal.
Sheet”sFig8c_PVT sti_Hargrove test_Ch”: Hargreaves behavioral responses to optogenetic stimulation of VLM terminals in the PVT of TH-Cre mice injected bilaterally with AAV-FLEX-Chrimson. Light OFF L/R: measurements of left/right hindpaw without optical stimulation (as control); Light ON L/R: measurements of left/right hindpaw with 20Hz optogenetic stimulation. Each row represents five repeated measurements from one animal.
Sheet”sFig8d_collateral”: Quantification of results from three animals with TH, CTB and Fluoro-Gold staining. Number of TH⁺, CTB⁺TH⁺, Fluoro-Gold⁺TH⁺ and Fluoro-Gold⁺, CTB⁺ and TH⁺neurons were quantified in each animal. TH⁺, CTB⁺ , Fluoro-Gold⁺ represents TH, CTB and Fluoro-gold immuno-positive neurons respectively.
Sheet”sFig8f_LC Gcamp6s_NBQXAP5”: Glutamate receptors antagonists NBQX and AP5 inhibit cVLM^TH-mediated optogenetic responses in the LC, but β-adrenergic receptor antagonist Propranolol did not. Peak intensity of jGCaMP7s fluorescence for ACSF, and for ACSF with glutamate receptor antagonists (ACSF+NBQX+AP5) was calculated for each neuron. ACSF: measurements in the presence of ACSF only. ACSF+NBQX+AP5: measurements in the presence of ACSF, NBQX and AP5.
Sheet”sFig8g_LC gcamp6s_propranolol”: peak intensity of jGCaMP7s fluorescence for ACSF, for ACSF with beta blocker Propranolol (ACSF + Propranolol). ACSF: measurements in the presence of ACSF only. ACSF+ Propranolol: measurements in the presence of ACSF and Propranolol.

Extended Data Fig. 9 Controls for optogenetic activation of terminals of cVLM^TH-neurons in the LC.

sFigure9.xlxs: includes the data in Extended Data Fig. 9b-d.

Sheet”sFig9b_Hargrove test_ChR2 LC_cL”: Withdrawal latencies in Hargreaves test with optogenetic activation of cVLM^TH neuron fiber terminals in the LC. Light OFF L/R: measurements of left/right hindpaw without optical stimulation (as control); Light ON L/R: measurements of left/right hindpaw with 20Hz optogenetic stimulation. Light ON + Yohimbine L/R: measurements of left/right hindpaw during optical stimulation with i.t. injection of Yohimbine.
Sheet”sFig9c_DREADDi_ondansetron”: Withdrawal latencies in Hargreaves test with serotonin 5-hydroytryptamine type 3 (5-HT3) receptor antagonist ondansetron. Veh L/R: Left/right hindpaw measurements after Vehicle injection. CNO L/R: Left/right hindpaw measurements after CNO injection. Ondansetron L/R: Left/right hindpaw measurements with i.t. injection of Ondansetron. CNO + Ondansetron L/R: Left/right hindpaw measurements with i.p. injection of CNO and i.t. injection of Ondansetron.
Sheet”sFig9d_DREADDi_AS19”: Withdrawal latencies in Hargreaves test with 5-hydroytryptamine type 7 (5-HT7) receptor agonist, AS19. Veh L/R: Left/right hindpaw measurements after Vehicle injection. CNO L/R: Left/right hindpaw measurements after CNO injection. AS19 L/R: Left/right hindpaw measurements with i.t. injection of Ondansetron. CNO + AS19 L/R: Left/right hindpaw measurements with i.p. injection of CNO and i.t. injection of Ondansetron.

Extended Data Fig. 10 Controls for photometry measurements of pain induced analgesia.

sFigure10.xlxs: includes the data in Extended Data Fig.10a-c

Sheet”sFig10a_representative trace”: Representative example of calcium responses of cVLM^TH neurons, measured using in vivo fiber photometry, from a single mouse to repeated noxious heat stimulation (on a hot plate; temperature ramps indicated above trace) before and after injection of capsaicin counter-stimulus into the fore paw (indicated with red arrow). A 1-hour rest period was included between naïve and counter-stimulus trials.
Sheet”sFig10b_cap lick”: Behavioral responses to heat challenge (heat ramp to 55 °C) on a hot plate before (Lick before CAP) and after (Lick after CAP) injection of capsaicin in the forepaw. Three repeated measurements for each animal. Lick before CAP: latency to lick (in seconds) before CAP injection. Lick after CAP: latency to lick after CAP injection
Sheet”sfig10c_cLVM_Gcamps6s_new forep”: Averaged in vivo photometry responses of cVLM^TH neurons for three trials (averaged) before and after a 1-hour rest period to heat challenges (3 x heat ramp to 55 °C) on a hot plate. Each column represents one animal.

Methods

Animals

All experiments using mice followed National Institutes of Health (NIH) guidelines and were approved by the National Institute of Dental and Craniofacial Research (NIDCR) ACUC. Mice were housed in small social groups (4–5 animals) in individually ventilated cages under 12-h light/dark cycles and fed ad libitum. Animals of both sexes aged 7–12 weeks were used in experiments. C57BL/6N wild-type mice were purchased from Envigo. TH-IRES-CreER mice (The Jackson Laboratory, 00852), TH-IRES-Cre mice (European Mouse Mutant Archive; stock no. EM:00254; backcrossed five generations with C57BL/6NJ mice) and Ai9 reporter mice (The Jackson Laboratory, 007909) were bred in-house. Animals were randomly allocated to the different experimental conditions reported in this study. Genotyping of offspring from all breeding steps was performed with genomic DNA isolated from tail snips.

Viral vectors

AAV2/5-Ef1a-DIO hChR2(E123T/T159C)-EYFP, AAV1-hSyn-Cre, AAV9-CAG-FLEX-GCaMP6s-WPRE-SV40 and AAV9-hSyn-eGFP were obtained from the Vector Core of the University of Pennsylvania. AAV9-CAG-FLEX-tdTomato, AAV2-mCherry-FLEX-dtA, AAV9-hSyn-DIO-mCherry-2A-Syb-GFP, AAV2-hSyn-DIO-hM4Di-mCherry, AAV2-Syn-DIO-mCherry, and AAV2-Syn-DIO-GFP were produced by the Vector Core of the University of North Carolina. AAVDJ-CAG-FLEX-TVA-mCherry was obtained from viral vector core at Salk Institute. AAVretro-CAG-GFP (Addgene no. 37825-AAVrg), AAV1-CAG-FLEX-jGCaMP7s-WPRE (Addgene, 104495-AAV1), AAV5-hSyn-FLEX-ChrimsonR-tdTomato (Addgene, 62723) and AAV2-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361-AAV2) were produced by Addgene. AAV2(retro)-CAG-iCre (Addgene, 81070) was produced by Vector Biolabs. AAV2/9-hSyn-FLEX-TVA-P2A-EGFP-2A-oG and EnvA-SAD-∆G-mCherry were gifts from Y. Liu at NIDCR/NIH. AAV8-CAG-FLEX-TCB (TVA-mCherry), AAV-EF1a-DIO-HB and EnvA-SAD-∆G-GFP were obtained from GT3 Core Facility of the Salk Institute. All viral vectors were stored in aliquots at −80 °C until use.

Anterograde tracing

AAV1-hSyn-Cre and AAVretro-CAG-GFP were bilaterally injected into lumbar SC of Ai9 mice. Postsynaptic neurons of SC-projecting neurons in the brainstem were labeled with tdTomato by AAV1-mediated anterograde transsynaptic tagging. Neurons labeled with both tdTomato and GFP are neurons projecting to lumbar SC.

Retrograde tracing

Three wild-type mice received stereotaxic injections of FG (2.0%, Fluoro-Gold; Fluorochrome) in the LC and CTB (0.5% Cholera Toxin B subunit, LIST Biological Laboratories) in the PVT. Brain tissues were collected 7 d after surgery and processed for histology. Antibodies against CTB (1:500 dilution; 703/AB_2314252, LIST Biological Laboratories) and FG (1:50 dilution; Fluorochrome) were applied along with anti-TH to identify cVLM noradrenergic neurons that project to PVT (TH- and CTB-positive neurons) or LC (TH- and FG-positive neurons), and cVLM noradrenergic neurons, which send collaterals to both.

Viral-mediated knockout of tyrosine hydroxylase

A guide (GCCAAGGTTCATTGGACGGCGG) specific to TH was used to generate virus (AAV-CMV-FLEX-SaCas9-U6-sgRNA-TH) following the procedures described previously³⁸. Virus was stereotaxically injected to the LC of TH-IRES-Cre mice and behaviors were measured after 3 weeks.

Pseudotyped rabies virus tracing

Helper AAVs (AAV2/9-hSyn-FLEX-TVA-P2A-EGFP-2A-oG, 200 nl per side) were bilaterally injected into the LC of TH-IRES-Cre mice. The fluorescent reporter (EGFP), the avian receptor (TVA) and the rabies envelope glycoprotein (G) were specifically expressed in noradrenergic neurons in the LC with a Cre-dependent manner. Pseudotyped rabies virus (EnvA-SAD-∆G-mCherry, 200 nl per side) were bilaterally injected into the same location in the LC 2 months later. The G-deficit pseudotyped rabies virus can only infect the noradrenergic neurons that expressed TVA receptor and glycoprotein G. The infectious viral particles generated in these noradrenergic neurons can trans-synaptically spread to presynaptic neurons that made a monosynaptic projection to LC noradrenergic neurons. For rabies virus tracing in the cVLM, helper AAVs (AA8-CAG-FLEX-TCB and AAV-EF1a-DIO-HB) were unilaterally injected into the cVLM, and pseudotyped rabies virus (EnvA-SAD-∆G-GFP, 200 nl) was injected 4 weeks later.

Drugs

CNO (Abcam, ab141704) was used at a dose of 0.75 mg per kilogram body weight in combination with the excitatory DREADDq and at a dose of 10 mg per kg body weight with inhibitory DREADDi virus. Estrogen receptor modulator, (Z)-4-Hydroxytamoxifen (Abcam, ab141943) was dissolved in corn oil at 20 mg ml⁻¹ and a single intraperitoneal injection of 100 µl corn oil induced Cre-mediated recombination in TH-IRES-CreER mice. Capsaicin (Sigma, M2028) was dissolved in alcohol at 100 mg ml⁻¹ and was diluted to a 1 mg ml⁻¹ working solution with PBS containing 5% Tween-20. Yohimbine hydrochloride was dissolved in dimethylsulfoxide and diluted to a 1 mg ml⁻¹ working solution with PBS. AS19 (Tocris, 1968) was dissolved in dimethylsulfoxide and diluted with PBS. Ondansetron hydrochloride (Tocris, 2891, 10 µg), clonidine hydrochloride (Tocris, 0690; 1 nmol) and AS19 (Tocris, 1968; 10 µg) were prepared with sterile PBS. CFA (Sigma, F5881; 10 µl⁻¹) was subcutaneously injected to induce inflammatory pain. 2-DG (Tocris, 4515, 500 mg per kg body weight) was injected intraperitoneally into the mouse 30 min after CNO administration and 30 min before Hargreaves tests.

Antibodies

Primary antibodies used were anti-c-Fos (1:500 dilution; goat polyclonal, Santa Cruz, sc-52-G; 1:50 dilution; rabbit monoclonal, Cell Signaling, 2250), anti-TH (1:1,000 dilution; rabbit polyclonal, EMD Millipore, AB152; 1:1,000 dilution mouse monoclonal, MAB5280 or 1:1,000 dilution, chicken polyclonal, Aves Labs, TYH), anti-mCherry (1:1,000 dilution, Thermo Fisher Scientific, rabbit polyclonal, PA5-34974), anti-GFP (1:500 dilution, chicken polyclonal, Aves Labs, GFP-1020 or 1:1,000 dilution, rabbit polyclonal, EMD Millipore, AB3080). Fluorophore-conjugated secondary antibodies were purchased from Thermo Fisher Scientific. Antibodies were diluted in PBS with 10% normal goat serum (NGS) and 0.3% Triton X-100 in PBS (PBST).

Stereotaxic surgery

All stereotaxic surgeries were conducted as described in our animal study protocol. Mice were anesthetized with a ketamine/xylazine solution (100 mg/10 mg in PBS) and a stereotaxic device (Stoelting) was used for viral injections at the following stereotaxic coordinates: cVLM, −2.50 mm from lambda, ±1.40 mm lateral from midline, and −5.30 mm vertical from cortical surface. LC, −5.50 mm from bregma, 0.95 mm lateral from midline, and −3.50 mm vertical from cortical surface. PVT, −1.6 mm from bregma, −0.06 mm lateral from midline with a six-degree angle, and −3.0 mm from cortical surface. AAVs were injected with an oil hydraulic micromanipulator (Narishige). AAVs were injected at a total volume of 0.1 μl in the cVLM. All other AAVs were injected at approximately 0.2–0.3 μl. Following stereotaxic injections, AAVs were allowed 2–3 weeks for maximal expression. Optical fibers with diameters of 200 μm (0.48 NA) and 400 μm (0.66 NA) were used for optogenetics and fiber photometry experiments, respectively (Doric Lenses). These fibers were implanted over the cVLM or LC immediately after viral injection and cemented using C&B Metabond Quick Adhesive Cement System (Parkell). Mice received subcutaneous injections with ketoprofen (5 mg per kg body weight) for analgesia and anti-inflammatory purposes pre-operatively and post-operatively and were allowed to recover on a heating pad.

Histology

Mice were euthanized with CO₂ and subsequently subjected to transcardiac perfusion with PBS and then with paraformaldehyde (4% in PBS). Brains were then postfixed in 4% paraformaldehyde at 4 °C overnight, and cryoprotected using a 30% PBS-buffered sucrose solution for ~24–36 h. Coronal brain sections (40 μm) were acquired using a cryostat (CM1860, Leica). For immunostainings, brain sections were blocked in 10% NGS in PBST for 1 h at room temperature (RT), followed by incubation with primary antibodies in 10% NGS-PBST for 24–48 h at 4 °C. Sections were then washed with PBST (3 × 15 min) and incubated with fluorescent secondary antibodies at RT for 1 h in 10% PBST. Sections were washed in PBS (3 × 15 min), mounted onto glass slides and cover-slipped with Fluoromount-G (Southern Biotech, 0100-01). Images were taken using a Nikon C2⁺ confocal microscope. Image analysis and cell counting were performed using ImageJ software by a blinded experimenter (Fiji, version 2017 May 30).

Fos expression

For c-Fos expression upon capsaicin or ATP administration to plantar skin, mice were anaesthetized with isoflurane (2%) for 5 min. PBS containing 10 nmol of capsaicin or 500 nmol of ATP were injected into the left hind paw of wild-type mice and then mice were returned to the home cage. Brain tissues were collected 1 h after injection and subjected to c-Fos immunohistochemistry analysis. For c-Fos expression in mice with AAV2-DIO-DREADDq-mCherry virus injection, brain tissues were collected 1 h after intraperitoneal injection of CNO.

In situ hybridization

Multi-label ISH was performed using the RNAscope technology (ACD) according to the manufacturer’s instructions. Probes against TH, DDC, DBH, PNMT, Slc18a2 (Vmat), Slc32a1 (Vgat) and Slc17a6 (Vglut2) in conjunction with the RNAscope multiplex fluorescence development kit. Images were collected on a Nikon C2⁺ confocal laser-scanning microscope.

Bulk Ca²⁺ and fiber photometry

Fiber photometry procedures and calcium measurements were performed by following methods previously described. Mice were first allowed to adapt to the experimental chambers and the attached fiber patch cord for 60 min before each testing session. A fiber photometry system (Doric Lenses) was used to record fluorescence signals. The system is integrated with two continuous sinusoidally modulated LEDs (DC4100, ThorLabs) at 473 nm (211 Hz) and 405 nm (531 Hz), which served as light source to excite GCaMP6s and an isosbestic autofluorescence signal, respectively. Fluorescence signals were collected by the same fiber implant that was coupled to a 400-µm optical patch cord (0.48 NA) and focused onto two separate photoreceivers (2151, Newport Corporation). The RZ5P acquisition system (Tucker-Davis Technologies), equipped with a real-time signal processor controlled the LEDs and also independently demodulated the fluorescence brightness from 473 nm and 405 nm excitation. The LED intensity (range 10–15 μW) at the interface between the fiber tip and the animal was constant throughout the session. All photometry experiments were performed in behavioral chambers, square enclosures on the hot plate (IITC Life Science) or mouse enclosures for Plantar Test Instrument (Ugo Basile). For ΔF/F analysis, a least-squares linear fit to the 405-nm signal to align it to the 470-nm signal was first applied. The resulting fitted 405-nm signal was then used to normalize the 473-nm signal as follows: ΔF/F = (473-nm signal − fitted 405-nm signal) / fitted 405-nm signal. For counter-stimulus experiments, mice were tested three times with 25–55 °C ramps, mice were given a 1-h rest and then injected with capsaicin (counter-stimulus). Next, a further three heat ramp trials were performed.

Combined optogenetic stimulation of LC terminals and photometry of LC^TH neurons

We used one optical fiber as described for photometry experiments. This fiber was connected to a six-port fluorescence mini cube (DoricLens), which allowed combined isosbestic excitation (400–410 nm), GCaMP excitation (460–490 nm) and emission (500–550 nm), and red fluorophore excitation (540–570 nm). Three light sources were used, a 405-nm LED for isosbestic excitation, a 473-nm LED for GCaMP6s excitation and a 561-nm laser for Chrimson excitation. Two separate photoreceivers collected isosbestic and GCaMP6s signals (2151, Newport Corporation). The intensity of illumination from the 473-nm LED was constant throughout the session and was adjusted to a minimal level to detect GCaMP6s signal (10–15 μW at the interface between the fiber tip). Activation of Chrimson was previously reported to occur from the excitation of GCaMP, and this effect would increase the baseline and reduce the signal-to-noise ratio of GCaMP6s signals. Therefore, illumination for GCaMP6s was reduced to a minimum to decrease this effect.

Optogenetics

TH-IRES-Cre mice injected with either Cre-dependent ChR2 or Cre-dependent GFP (control) in the cVLM and an optical fiber placed above cVLM were behaviorally tested 3 weeks later. Mice were tethered with an optical patch cord and placed in the Perspex enclosure (10 cm × 10 cm × 15 cm) with free movements. After habituation for 60 min, Hargreaves tests were performed to measure the baseline of hind paw withdrawal latency. Then, mice received light stimulation with a blue LED (470 nm; Thorlabs, M470F1) at a frequency of 20 Hz (10 ms width) for 2 min. Hargreaves tests were carried out to measure the hind paw withdrawal latency during the stimulation and at 2 min, 5 min, 10 min, 20 min and 30 min after cessation of stimulation. For optical activation with Chrimson, a 561-nm laser (Opto Engine, 561-50 mW) was used to generate light stimulation at a frequency of 20 Hz (10 ms width) for 2 min during which Hargreaves tests were performed.

Mouse behavioral measurements

All behavioral experiments were conducted during the light cycle at ambient temperature (~23 ˚C). For all behavioral paradigms, the experimenter was blinded to the genotype of mice under study. Ear-tag numbers were read after experiments and results were unblinded after testing sessions.

Hargreaves test

Mice were habituated to the testing enclosures (Ugo Basile) for 60 min. Habituation was repeated for 2 d. On testing day, after the mice were acclimatized for 60 min in the testing enclosure, a radiant heat beam was applied to the center of the hind paw and reaction time between the start of the heat stimuli and lifting the hind paw was recorded as the hind paw withdrawal latency. A cutoff time of 15 s was used to prevent tissue damage. Consecutive tests of the same paw were separated by at least 3 min. The test was repeated for five trials for both left and right hind paws. The averages of the withdrawal latencies were calculated. Mild burn was achieved by placing the hind paw, while mice were deeply anesthetized, in a water bath at 55 °C for 15 s.

Cold plantar test

Cold responses were tested as described previously. Briefly, a dry ice pellet was applied below the hind paw of a mouse sitting on a glass surface and time to withdrawal was measured. Withdrawal was tested five times for each hind paw, and consecutive tests of the same paw were separated by at least 3 min.

Itch test

Behavioral assessment of scratching behavior was conducted as described previously. Briefly, mice were injected subcutaneously into the nape of the neck with chloroquine. Compounds were diluted in PBS. Scratching behavior was recorded for 30 min and is presented in numbers of bouts observed in 30 min. One bout was defined as scratching behavior toward the injection site between lifting the hind leg from the ground and either putting it back on the ground or guarding the paw with the mouth. Injection volume was always 10 μl.

Von Frey test

Mechanical sensitivity thresholds were assessed using calibrated von Frey filaments using the simplified up–down method. Animals were acclimatized in a plastic cage with a wire mesh floor for 1 h and then tested with von Frey filaments with logarithmically incremental stiffness (starting with 0.4 g). Each filament was applied for 5 s, and the presence or absence of a withdrawal response was noted. The filament with the next incremental stiffness was then applied, depending on the response to the previous filament, and this was continued until there were six positive responses. The filaments were applied to the glabrous skin on the hind paw, and a positive response was recorded when there was lifting or flinching of the paw. The force required for 50% withdrawal was determined by the up–down method.

Rotarod test

Motor coordination was tested by measuring the performance on an accelerating rotarod (IITC Life Science) with the rod programmed to accelerate from 4 to 40 r.p.m. over 5 min. During the experimental testing session, the mice were allowed two trial runs followed by four test runs and the average of the maximum r.p.m. tolerated was recorded. For each mouse, the maximum times on the rota-rod were averaged.

Hot plate test

Hot plate tests (IITC Life Science) were used to assess the nociception upon a high-temperature stimulus. The latency to lick a hind paw when the mouse was placed on a 52.0 °C hot plate was measured. The plate was enclosed with four Plexiglas walls and a lid so that the mouse could not escape. The mouse was removed from the plate after 30 s.

Randall–Selitto test

A modified Randall–Selitto device (IITC Life Science) was used to automatically measure the responses when pressure was applied to the tail. The mouse was placed into a mouse restrainer with the tail exposed to access with a handheld probe. Pressure was applied to the tail until a response was observed. The maximum force applied during the test was recorded.

Feeding behavior

As described in a previous paper, TH-IRES-Cre mice injected with either Cre-dependent ChR2 or Cre-dependent mCherry (control) in the cVLM and an optical fiber placed above the pPVT or LC were behaviorally tested 3 weeks later. First, mice were tethered with an optical patch cord and placed in an open-field box (45 × 45 × 40 cm) where they were given access to 20 mg food pellets for 30 min (pre-test). Immediately after the pre-test, mice received light stimulation with a blue laser tuned at 473 nm at a frequency of 20 Hz (duration, 10 ms) for 30 min using a 1 min ‘ON’/2 min ‘OFF’ protocol (stimulation). After light stimulation, mice were given another 30 min with access to food (post-test). In addition, for these mice, the duration, quantity and timing of feeding epochs were quantified using a custom-designed feeding experimentation device (FED3). The power of the blue laser for all experiments was 5–10 mW, measured at tip of the patch cord.

Bulk Ca²⁺ recordings in brain slices

TH-IRES-Cre mice were bilaterally injected with AAV5-Syn-FLEX-ChrimsonR-tdTomato virus in cVLM (100 nl per side) and AAV1-CAG-FLEX-jGCaMP7s-WPRE in LC (200 nl per side). Three to four weeks later, mice were anesthetized with isoflurane and transcardially perfused with ice-cold NMDG artificial cerebrospinal fluid (ACSF) (92 mM NMDG, 2.5 mM KCl, 1.25 mM NaH₂PO₄, 30 mM NaHCO₃, 20 mM HEPES, 20 mM glucose, 2 mM thiourea, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 0.5 mM CaCl₂·4H₂O and 10 mM MgSO₄·7H₂O; titrate pH to 7.3–7.4 with concentrated hydrochloric acid). Coronal sections containing LC (300 µm thick) were sectioned with a VT1200S automated vibrating-blade microtome (Leica Biosystems) and were subsequently transferred to an incubation chamber containing NMDG ACSF (34–35 °C). After 12 min of recovery, slices were transferred to a modified ACSF (92 mM NaCl, 2.5 mM KCl, 30 mM NaHCO₃, 1.25 mM NaH₂PO₄, 25 mM glucose, 20 mM HEPES, 2 mM thiourea, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 2 mM MgSO₄ and 2 mM CaCl₂, pH 7.4, gassed with 95% O₂ and 5% CO₂) at RT (20–24 °C) and remained until imaged. For imaging, slices were placed in the recording chamber containing ACSF (118 mM NaCl, 2.5 mM KCl, 26.2 mM NaHCO₃, 1 mM NaH₂PO₄, 20 mM glucose, 2 mM MgCl₂ and 2 mM CaCl₂, at 20–24 °C, pH 7.4, gassed with 95% O₂ and 5% CO₂) and remained there until imaging finished. Images were obtained using a fluorescence microscope (Olympus BX51 microscope) with an Orca Flash 4.0 LT camera and HCImage Live (Hamamatsu) software at two images per second. Light stimulation was achieved using a red laser (635 nm) delivered in 20 Hz for 20 s to activate Chrimson. An LED (Lumen 300-LED, Prior Scientific) was used to activate jGCaMP7s. Images obtained before light stimulation served as baseline, and the fluorescence changes of jGCaMP7s after light stimulation were analyzed with ImageJ. TTX (1 µM) and 4-AP (100 µM) were applied to isolate the monosynaptic response. To isolate the noradrenergic or glutamatergic effects on GCaMP responses, initial recordings were made in ACSF to establish a baseline response, then selective antagonists were applied via the bath. For slices from three different mice, we applied via the bath the beta-adrenergic receptor antagonist propranolol (10 µM) and recorded GCaMP responses at least 10 min after initial application of the antagonist. For slices from a separate set of three mice, we simultaneously applied via the bath the AMPA receptor agonist NBQX (10 µM) and the NMDA receptor antagonist AP5 (50 µM) and recorded GCaMP responses after at least 10 min had passed since initial application of the antagonists. All antagonists were purchased from Tocris (Bio-Techne).

Statistics and reproducibility

Prism 8.0 (GraphPad) was used for statistical analyses. Differences between mean values were analyzed using an unpaired two-tailed Student’s t-test. Differences were considered significant for *P < 0.05, **P < 0.001, ***P < 0.001 and exact P values are given in the respective figure legend. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications. Data distribution was assumed to be normal but this was not formally tested. Data collection and analyses were not performed blind to the conditions of the experiment and randomization was not used. No data were excluded from data analysis except where post hoc analysis revealed viral transgene expression was absent in the intended site of injection and where animals were removed from study for humane health reasons. Both criteria were preestablished.