Skip to main content
Dryad logo

RNA sequences for Aedes species, Dengue and Chikungunya viruses

Citation

Ngala, Jonathan (2020), RNA sequences for Aedes species, Dengue and Chikungunya viruses, Dryad, Dataset, https://doi.org/10.5061/dryad.nk98sf7r6

Abstract

There are arthropod-borne disease outbreaks as a result of pathogen influx including arboviruses which are transmitted by strains of Aedes species that occur periodically in varying spots on the globe. The aim of this study was to determine phylogenetic relationship of Aedes mosquitoes, Dengue and Chikungunya viruses along the Coastline of Kenya based on sequences of:

  1. mitochondria nicotinamide adenine dehydrogenase sub unit 4 gene for Aedes species.
  2. non-structural protein 5 gene for Dengue virus
  3. non-structural protein 1 gene for Chikungunya virus

Methods

Sample collection: Indoor and outdoor sampling of adults Aedes mosquitoes was done using Biogent Sentinel trap baited with solid carbon dioxide and Prokopack aspiration technique.

RNA extraction and cDNA synthesis

Pools of Aedes mosquitoes (20 mosquitoes per pool) were homogenized by a mortar and pestle and RNA extracted using 1 ml of Trizol® as earlier described. Only the unfed and gravid mosquitoes were utilised in this analysis. The female blood-fed were excluded to avoid contamination of the virus which could be in the blood meal. cDNA synthesis was done on 10 μl of the extracted RNA to generate cDNA by using EcoDry Premix (Random hexamers) (Clontech laboratories, Inc., Mountain view, CA, USA) in a procedure described earlier 6,15.

Molecular Identification and sequencing of Aedes mosquitoes and Viruses 

The mtNAD4 gene was utilised for identification of Aedes mosquitoes using primers listed (Table 1) as earlier described. Identification of serotypes of Dengue virus in the Aedes mosquitoes was based on amplification of the target viral genes (E/NS1/NS5) in RNA using multiplex PCR with a panel of general flavivirus family primers (Table 2) as earlier described. Samples tested positive for flavivirus were further tested with consensus primers for Dengue virus. These primers were DEN-F and DEN-CR and they target the E/NS1 junction of the virus genome. Only samples tested positive with Dengue consensus primers were further tested for the four Dengue serotypes using appropriate primers (Table 3) as described. Identification of genotypes of Chikungunya virus was based on amplification of the target viral gene E1 in the RNA using multiplex PCR with AgPath-ID One-step RT-PCR kit (Applied bio systems, Carlsbad, Califonia, USA) using a panel of general alphaviruses primers (Table 2). Samples tested positive for alphavirus were further tested with conventional primers for Chikungunya virus (Table 4). The amplified gene products were cleaned from the gel by MinElute PCR purification kit (Qiagen, Valencia, CA) and sequenced using Sanger high-throughput technique.

Sequence analysis:

Generated nucleotide sequences were used for phylogenetic analysis. DNAbaser v.3.0 (http://www.dnabaser.com/articles/SNP) was used for editing bad calls in the raw chromatogram file generated from sequencing the forward and reverse strands. Deletion of the generated sequences of primers was done from the 5’ and 3’ ends. The sequences were subjected to Basic Local Alignment Tool (BLASTn) and GenBank database to compare them with available sequences and confirm the identity of the isolates. Formatting of the retrieved sequences compatible with alignment programs and identification of correct reading frame for each sequence was done using the translation program at http://us.expasy.org/tools/dna.html.

The sequences were aligned for identification and removal of duplicate sequences using Clustal Omega v1.2.1, scored in T-coffee (http://tcoffee.crg.cat/) and viewed in jalview http://www.jalview.org/ (Sievers and Higgins, 2014). The sequences were manually adjusted in Se-Al software according to DNA sequence alignments for preservation of codon homology. Columns with more than one percent of gaps were removed from the alignment using trimAl v1.4.rev6. Using pmodeltest v1.4, Maximum likelihood trees were inferred using Randomised Accelerated Maximum Likelihood (RAxML) version 8.1.20 ran with model GTR+GAMMA+I for selecting the best-fit model for the maximum likelihood analyses and plotting of phylogenetic trees using interactive tree of life (https://itol.embl.de/).

Table 1: Primers used in identification of Aedes mosquitoes

Target

Primer name

Nucleotide sequences (5’ to 3’)

Polarity

Product (bp)

Mosquito RNA marker (UP)

Act-2F

ATGGTCGGYATGGGNCAGAAGGACTC

Forward

683

 

Act-8R

GATTCCATACCCAGGAAGGADGG

Reverse

 

Ae. aegypti s.l

18SFHIN

 

 

CP16

GTAAGCTTCCTTTGTACACACCGCCCGT

GCGGGTACCATGCTTAAATTTAGGGGT

Forward

550

 

Aeg.r1

TAACGGACACCGTTCTAGGCCCT

Reverse

 

Ae. tricholabis

UV

TGTGAACTGCAGGACACAT

Forward

 

Ae. pembaensis

PEM

GCATCGATGGGTTAATCATG

Reverse

405

Ae. ocharaceous

OCH

CAAGCCGTTCGACCCTGATT

Reverse

501

Ae. albicosta

ALB

CCTGGCCAGTGGCCAAAT

Reverse

 

Ae. fulgens

FUL

GTGCACACCACTGAATT

Reverse

 

Ae. mcntoshi

MCN

CTGATGCACTGGCCTCAAAG

Reverse

 

Ae. fryeri

FRR

TCAACCGCCGTGCGTG

Reverse

 

ND4

ND4sb+

TGATTGCCTAAGGCTCATGT

Forward

344

 

ND4sb-

TTCGGCTTCCTAGTCGTTCAT

Reverse

 

 

Table 2: Primers and probes for identification of flaviviruses and alpha viruses

 

Primers and Probes

Sequence

Tm o

Flavivirus

 

 

Flavi allS (Forward Primer)

5’-TACAACATgATggggAARAgAgARAA-3’

53.8

Flavi all AS2 (Reverse Primer)

5’-gTgTCCCAgCCNgCKgTgTCATCWgC-3’

 

Flavi all AS4 (Reserve Primer)

5’-gTgTCCCAGCCNgCKgTRTCRTC-3’

80.4

3Pi (Probe)

FAM-Tg+gTWYATgT+ggYTNg+gRgC-NFQ-MGB

50.3

3Pii (Probe)

FAM-CCgTgCCATATggTATATgTggCTgggAgC-NFQ-MGB

 

3Piii (Probe)

FAM-TTTCTggAATTTgAAgCCCTgggTTT-NFQ-MGB

 

Pan-alphavirus

 

 

F2A (Forward Primer)

5’- ATGATGAARTCIGGIATGTTYYT-3’

 

R2A (Reverse Primer)

5’-ATYTTIACTTCCATGTTCATCCA-3’

 

R3A (Reverse Primer)

5’-ATYTTIACTTCCATRTTCARCCA-3’

 

R4A (Reverse Primer)

5’-ATYTTIACTTCCATGTTGACCCA-3’

 

ATTO425 (Probe)

- AT+GTT+GTC+GT+CIC+CIAT-BHQ1/LNA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 3: Primers for identification of serotypes of Dengue virus

Primer

Gene/ protein target

Primer sequence (5’ to 3’)

Position

FU1

NSP5

TACAACATGATGGGAAAGAGAGAGAA

9007-9032

CFD3

NSP5

GTGTCCCAGCCGGCGGTGTCATCAGC

9308-9283

DEN-F

E/NS1

TCAATATGCTGAAACGCGCGAGAAACCG

38-65

DEN-CR

E/ NS1

TTGCACCAACAGTCAATGTCTTCAGGTTC

455-483

TS1-R

NSP5

CGTCTCAGTGATCCGGGGG (DEN-F and TS1)

 

TS2-R

NSP5

CGCCACAAGGGCCATGAACAG (DEN-F and TS2)

 

TS3-R

NSP5

TAACATCATCATGAGACAGAGC(DEN-F and TS3)

 

TS4-R

NSP5

CTCTGTTGTCTTAAACAAGAGA(DEN-F and TS4)

 

D5-F

NSP5

TCAATATGCTGAAACGCGHGAG

132-153

D5-R

NSP5

GCGCCTTCNGNNGACATCCA

764-783

 

 

Table 4: Primers for identification of Chikungunya virus

Primer

Gene/ protein target

Primer sequence (5’ to 3’)

Position

VIR 2052 F

NSP4

TGGCGCTATGATGAAATCTGGAATGTT

6971-6997

VIR 2052R

NSP4

TACGATGTTGTCGTCGCCGATGAA

7086–7109

CHIKV-F

E1

CGTGGTGTACAAAGGTGACG

10524

CHIKV-R

CHIKWa

CHIKAs

CHIKECSa

E1

NSP1

NSP1

NSP1

ACG CCG GGTAGTTGACTATG

GGCAAACGCAGTGGTACTTCCT

GGCAGACGCAGTGGTACTTCCT

TGATCCCGACTCAACCATCCT

11170

295-316

295-316

234-254