Skip to main content
Dryad logo

Reference standard single molecule RNA FISH images

Citation

Duncan, Susan; Johnasson, Hans; Ding, Yiliang (2022), Reference standard single molecule RNA FISH images , Dryad, Dataset, https://doi.org/10.5061/dryad.vt4b8gtvp

Abstract

The aim of our study was to validate the first panel of reference standard probe sets for Arabidopsis single molecule RNA FISH. To achieve this, we applied stringent probe design rules to genes with reportedly low levels of mRNA perturbation during development or in response to biotic and abiotic stress. Sequence-associated factors that could impact probe binding specificity and efficiency ruled out many candidates and four were selected for image assessment: MON1 (AT2G28390), TIP41 (AT4G34270), AP2M (AT4G35800) and NRPB1 (AT4G35800). A previously published control probe set was also analysed - PP2A (AT1G13320). This dataset includes all of the raw images analysed as part of this study.

Methods

Single-molecule RNA FISH probes conjugated with Quasar 670 dye were designed to detect MON1 (AT2G28390), TIP41 (AT4G34270), AP2M (AT4G35800), NRPB1 (AT4G35800) and PP2A (AT1G13320) mRNA. These probes were applied to Arabidopsis root meristem cells of 5-day-old Columbia (Col-0) seedlings. Nuclei were also stained with DAPI.

Protocol details can be found here: https://www.protocols.io/private/E594823C1ED911ED91FF0A58A9FEAC02

Details of the microscope setup used to acquire these raw images:

Microscope model and manufacturer Zeiss Elyra PS1 inverted wide-field microscope
Acquisition software Zen 2.3 (Black)
Objective Plan-Apochromat 100x/NA 1.46 DIC
Immersion Oil
Camera Andor iXon 897 (512x512, QE>90%)
Voxel Size x/y 100 nm, z 200 nm
Frame Averaging 1
Acquisition  Complete z-stacks were acquired for Q670 probes then DAPI, sequentially.
Q670 probe detection laser 642 nm laser diode
Q670 probe emission bandwidth LP655 nm
Q670 probe exposure time 1000 ms
Q670 probe EM Gain 24
DAPI detection laser 405 nm laser diode
DAPI emission bandwidth 420-480 nm
DAPI exposure time 300 ms
DAPI EM Gain 25

Probe sets used as part of this study are listed below:

AT2G28390 (MON1) AT4G34270 (TIP41) AT4G35800 (NRPB1) AT5G46630 (AP2M) AT1G13320 (PP2A)
ggagaagacctcgaatctga cggactatccaaccaagac aacggaaacctcgtatccat tcgacgacggagcaaaggaa ccgagcgatctatcaatcag
cgaattcggtgtcggatgat gatgtcacttgtgtgacca tccgatcaatcgtaccaaga tgagatttgaggttcgacga gacatcctcaccaaaactca
atcggagctaggatttggat cactaccttttctcctccg agccatattagccatacatg gacgatctggttacaggaga tcgggtataaaggctcatca
ttgaacacgctccgaattcg tctgaatcgccggctaata gcttagcgagctcaagatag tcgccacggagattcagaaa tagctcgtcgataagcacag
agacttcgctaggttgagat ctttatcgaccaccgtctc ctgcttaaacttatgctcct cggtaggtgcgatttatgag ccaagagcacgagcaatgat
gatgcaacctcatcatcatt ccccggaagacttcagaac gcctattcttaggattcttg aaatgcatccaccatgtttc atcaactcttttcttgtcct
ccacaccttcacgcaataaa gacgtccgtcgggaagaag gctcttttttactggttcat tcgtctgcattatatgcgta catcgtcattgttctcacta
cttaacaaaacctctcctcc agtcatggatgcgtaaacc accctcaatagtcagttttg cacaggacaattccctaact atagccaaaagcacctcatc
cttccatcatcagctttata cgcggagggtttcgatctc tgacaatccgcgtcactaat taaacaaaggagcagccacc atacagaataaaacccccca
attagcttccctaatctcat cttcgacagcgagagaagt aggacgagcaaacttagggt tgtagacattgctgattcgc caagtttcctcaacagtgga
ctcatcaacatggcgttttc tcttaagctttttttccca gggtggaggaataggaagga gcaacattagcattgctact tcatctgagcaccaattcta
tccatgacgtagaagcatca ccatttcaggtaagtgaga ctgccttttcaagttttcat agctacagcctcaacaacaa tagccagaggagtgaaatgc
tgcctgagttactcagtatg gactaatgcattctcgcca gtgccgagaaatcaacacgt gctccaccaaagtatgattt cattcaccagctgaaagtcg
gttcatctccatatctggaa gtgttgctacctaagtgtt cagagcaatactccacggaa ttctaatagcgtcttcatca ggaaaatcccacatgctgat
gctgaaaatccagcaagctt accagctagtgcgtcaaac gtccataatcaacaagctcc agagattttgtggatagcca atattgatcttagctccgtc
accaccattctccacaaaag caacaggtggaagcccttc ctggggggagacaatacatt acaccttcctgagtgatata attggcatgtcatcttgaca
ccttgactaagttgacacgg attgtgctgcagcaggaac agaggacgaggcttcaagat gtcttttggcttcgatgaaa aaattagttgctgcagctct
aagacaacctggtgatttcc acggcttgctcctgaattt gcagagtacctcaacagatt atgttgcatttggaacaggt gctgattcaattgtagcagc
agatatattggccccttaac aatctagtatcacctgctg gcaaagagttccggcaagaa caaccaacagcacctgtaac ccgaatcttgatcatcttgc
tgtttcatctgtacagctga ggcgttgtaaacgtgtaat tccattagatgtaccaaggg ttctttttgtaagcaaggcc caaccctcaacagccaataa
tatagaagatccaactgccc actacttcacttccacagt aacctcttcccaaatgacat cactttccacaatatccaga ctccaacaatttcccaagag
gcaagggtgtcatatcgaac accgtttctttgtctttct cgaggaattttctagctgca ttgcctttagaggacatcag caaccatataacgcacacgc
tgagaagacagcatctgtcc tttggattagcttttgcct aattgtgtcaccaattccga cgtcacatcacaccgaagaa agtagacgagcatatgcagg
ctgggttccagctaaatgaa cactgaagagtagcttccc actgccggataagatctttc aggcattcccgaaaggaaac gaacttctgcctcattatca
ccttaacgcatatggaaggg atctgatcttcacagttct tggttaaccctgttctcaaa cattcaaccccaacttcaaa cacagggaagaatgtgctgg
acttcttgcaatatggttcc ttaagtgagagagcagcca gcatcatcacgagctttatt tccttctcaagaccaatttt tgacgtgctgagaagagtct
gaataagacaccagacgcgc gccagttcatcttcataca caacattttgctgaccgaca tgggcgagatttcatttctg cccattataactgatgccaa
tgtgtctgcacattagtagt cagtcagaagtgacactcc tttcaaggaatccagcttct ctcaatggttttaccactct tggttcacttggtcaagttt
gtagaagcaagtcatcggga cttggcatgactctcactt cccttcaagtcttcaagatg caggttcacacactggtgaa tctacaatggctggcagtaa
tgagcgttgtatcttggtag tcgcaagaggaggaaccat cgagttggaatctgtcagtc acagtcttctcggagttgaa cgattatagccagacgtact
agaagtggacataggcatgc gcacaccatcaactctcag caagtgctatcaccatttgt gatttacaccctctgttatt gactggccaacaagggaata
gaacgcatctgaacgtgtgg ctcgtctctctcaatctca cagatatgcctcttgatgtt gtgtacgaccaagttctttg catcaaagaagcctacacct
taccctgcaatctttgagat tcgccaaacctataatgca tcaacagggtgcatatctga accttgacatttacttccat ttgcatgcaaagagcaccaa
cgcgattgatctttgaacca cgaagaacagttggtgcct cacactcaacgcatcatcac agggcaaacattttagcacc acggattgagtgaaccttgt
ggtacatcttcaacacgcat atgttgcttctctccaaca attgagcagcaacacaaccg tggaattttaaccacgaccc cttcagattgtttgcagcag
tagtagatgatcgacgcctg taccctttcgcagatagag cgtaacgttctttgcactga cttggaaattggtcttggct ggaccaaactcttcagcaag
ggtgagtcttgttcttgatt ctccagactgctaagtcaa tgttttgatcctcttagcta tggattgtatttagcgcgac ggaactatatgctgcattgc
atgccaaagtccaaagggac tgactgatggagctcgggt ccggagtgagatagactgat cttagcgtggactctgtttg gtgggttgttaatcatctct
gttactgggggtgagaattc tgcttaatcactggaagcc acatcttcatctggcatttc ccattgttgagatcaactca tgcacgaagaatcgtcatcc
gacttttctgttgtctgtga gggatcttcagtttctgtg aagtagccacggagatatct cttgtccaagatttcttctc ttactggagcgagaagcgat
agtttctggtatgctcgata aaagctcatcggtacgctc catctcgcgattcaactcta tgtgaacattggcacctgaa gaacatgtgatctcggatcc
ccaatccttttacatgcatt agtagtttgtttggctgta gatgtctggaatacctctga aacgaactcgcagaccagat ctctgtctttagatgcagtt
gtgtagttttcatctcttct agtcagtggagtaactcct agcaaagcacgacgaactgc ttatgtatcgaacccactcg catcattttggccacgttaa
tggtgtgacccaacatagaa gttcatatgaaaccaccac cgagtgatagccatcagatg cagcatctgatctcgtaaga cgtatcatgttctccacaac
gcaagtggatcaaatgctgc   tcttcagcatctcatcattc   atcaacatctgggtcttcac
cacacctgattgcatatctt   atagctagggagctgaagtt   ttggagagcttgatttgcga
cttcattctccacatctttt   tgacactggtgaacgagcag   acacaattcgttgctgtctt
aaaggactagctccttgcaa   catcatgccttcatggtaag   cgcccaacgaacaaatcaca

Usage Notes

ImageJ

Funding

Gatsby Charitable Foundation

John Innes Foundation

Biotechnology and Biological Sciences Research Council, Award: BBS/E/J/000PR9788

European Research Council, Award: 680324