Skip to main content
Dryad

Reference genes for quantitative Arabidopsis single molecule RNA fluorescence in situ hybridization

Cite this dataset

Duncan, Susan; Johansson, Hans E; Ding, Yiliang (2023). Reference genes for quantitative Arabidopsis single molecule RNA fluorescence in situ hybridization [Dataset]. Dryad. https://doi.org/10.5061/dryad.vt4b8gtvp

Abstract

Abstract Subcellular mRNA quantities and spatial distributions are fundamental for driving gene regulatory programmes. Single molecule RNA fluorescence in situ hybridization (smFISH) uses fluorescent probes to label individual mRNA molecules, thereby facilitating both localization and quantitative studies. Validated reference mRNAs function as positive controls and are required for calibration. Here we present selection criteria for the first set of Arabidopsis smFISH reference genes. Following sequence and transcript data assessments, four mRNA probe sets were selected for imaging. Transcript counts per cell, correlations with cell size, and corrected fluorescence intensities were all calculated for comparison. In addition to validating reference probe sets, we present sample preparation steps that can retain green fluorescent protein fluorescence, thereby providing a method for simultaneous RNA and protein detection. In summary, our reference gene analyses, modified protocol, and simplified quantification method together provide a firm foundation for future quantitative single molecule RNA studies in Arabidopsis root apical meristem cells.

Methods

Single-molecule RNA FISH probes conjugated with Quasar 670 dye were designed to detect MON1 (AT2G28390), TIP41 (AT4G34270), AP2M (AT4G35800), NRPB1 (AT4G35800) and PP2A (AT1G13320) mRNA. These probes were applied to Arabidopsis root meristem cells of 5-day-old Columbia (Col-0) seedlings. Nuclei were also stained with DAPI.

Protocol details can be found here: https://www.protocols.io/view/modified-arabidopsis-root-smrna-fish-protocol-rm7vzyworlx1/v1

Details of the microscope setup used to acquire these raw images:

Microscope model and manufacturer Zeiss Elyra PS1 inverted wide-field microscope
Acquisition software Zen 2.3 (Black)
Objective Plan-Apochromat 100x/NA 1.46 DIC
Immersion Oil
Camera Andor iXon 897 (512x512, QE>90%)
Voxel Size x/y 100 nm, z 200 nm
Frame Averaging 1
Acquisition  Complete z-stacks were acquired for Q670 probes then DAPI, sequentially.
Q670 probe detection laser 642 nm laser diode
Q670 probe emission bandwidth LP655 nm
Q670 probe exposure time 1000 ms
Q670 probe EM Gain 24
DAPI detection laser 405 nm laser diode
DAPI emission bandwidth 420-480 nm
DAPI exposure time 300 ms
DAPI EM Gain 25

Probe sets used as part of this study are listed below:

AT2G28390 (MON1) AT4G34270 (TIP41) AT4G35800 (NRPB1) AT5G46630 (AP2M) AT1G13320 (PP2A)
ggagaagacctcgaatctga cggactatccaaccaagac aacggaaacctcgtatccat tcgacgacggagcaaaggaa ccgagcgatctatcaatcag
cgaattcggtgtcggatgat gatgtcacttgtgtgacca tccgatcaatcgtaccaaga tgagatttgaggttcgacga gacatcctcaccaaaactca
atcggagctaggatttggat cactaccttttctcctccg agccatattagccatacatg gacgatctggttacaggaga tcgggtataaaggctcatca
ttgaacacgctccgaattcg tctgaatcgccggctaata gcttagcgagctcaagatag tcgccacggagattcagaaa tagctcgtcgataagcacag
agacttcgctaggttgagat ctttatcgaccaccgtctc ctgcttaaacttatgctcct cggtaggtgcgatttatgag ccaagagcacgagcaatgat
gatgcaacctcatcatcatt ccccggaagacttcagaac gcctattcttaggattcttg aaatgcatccaccatgtttc atcaactcttttcttgtcct
ccacaccttcacgcaataaa gacgtccgtcgggaagaag gctcttttttactggttcat tcgtctgcattatatgcgta catcgtcattgttctcacta
cttaacaaaacctctcctcc agtcatggatgcgtaaacc accctcaatagtcagttttg cacaggacaattccctaact atagccaaaagcacctcatc
cttccatcatcagctttata cgcggagggtttcgatctc tgacaatccgcgtcactaat taaacaaaggagcagccacc atacagaataaaacccccca
attagcttccctaatctcat cttcgacagcgagagaagt aggacgagcaaacttagggt tgtagacattgctgattcgc caagtttcctcaacagtgga
ctcatcaacatggcgttttc tcttaagctttttttccca gggtggaggaataggaagga gcaacattagcattgctact tcatctgagcaccaattcta
tccatgacgtagaagcatca ccatttcaggtaagtgaga ctgccttttcaagttttcat agctacagcctcaacaacaa tagccagaggagtgaaatgc
tgcctgagttactcagtatg gactaatgcattctcgcca gtgccgagaaatcaacacgt gctccaccaaagtatgattt cattcaccagctgaaagtcg
gttcatctccatatctggaa gtgttgctacctaagtgtt cagagcaatactccacggaa ttctaatagcgtcttcatca ggaaaatcccacatgctgat
gctgaaaatccagcaagctt accagctagtgcgtcaaac gtccataatcaacaagctcc agagattttgtggatagcca atattgatcttagctccgtc
accaccattctccacaaaag caacaggtggaagcccttc ctggggggagacaatacatt acaccttcctgagtgatata attggcatgtcatcttgaca
ccttgactaagttgacacgg attgtgctgcagcaggaac agaggacgaggcttcaagat gtcttttggcttcgatgaaa aaattagttgctgcagctct
aagacaacctggtgatttcc acggcttgctcctgaattt gcagagtacctcaacagatt atgttgcatttggaacaggt gctgattcaattgtagcagc
agatatattggccccttaac aatctagtatcacctgctg gcaaagagttccggcaagaa caaccaacagcacctgtaac ccgaatcttgatcatcttgc
tgtttcatctgtacagctga ggcgttgtaaacgtgtaat tccattagatgtaccaaggg ttctttttgtaagcaaggcc caaccctcaacagccaataa
tatagaagatccaactgccc actacttcacttccacagt aacctcttcccaaatgacat cactttccacaatatccaga ctccaacaatttcccaagag
gcaagggtgtcatatcgaac accgtttctttgtctttct cgaggaattttctagctgca ttgcctttagaggacatcag caaccatataacgcacacgc
tgagaagacagcatctgtcc tttggattagcttttgcct aattgtgtcaccaattccga cgtcacatcacaccgaagaa agtagacgagcatatgcagg
ctgggttccagctaaatgaa cactgaagagtagcttccc actgccggataagatctttc aggcattcccgaaaggaaac gaacttctgcctcattatca
ccttaacgcatatggaaggg atctgatcttcacagttct tggttaaccctgttctcaaa cattcaaccccaacttcaaa cacagggaagaatgtgctgg
acttcttgcaatatggttcc ttaagtgagagagcagcca gcatcatcacgagctttatt tccttctcaagaccaatttt tgacgtgctgagaagagtct
gaataagacaccagacgcgc gccagttcatcttcataca caacattttgctgaccgaca tgggcgagatttcatttctg cccattataactgatgccaa
tgtgtctgcacattagtagt cagtcagaagtgacactcc tttcaaggaatccagcttct ctcaatggttttaccactct tggttcacttggtcaagttt
gtagaagcaagtcatcggga cttggcatgactctcactt cccttcaagtcttcaagatg caggttcacacactggtgaa tctacaatggctggcagtaa
tgagcgttgtatcttggtag tcgcaagaggaggaaccat cgagttggaatctgtcagtc acagtcttctcggagttgaa cgattatagccagacgtact
agaagtggacataggcatgc gcacaccatcaactctcag caagtgctatcaccatttgt gatttacaccctctgttatt gactggccaacaagggaata
gaacgcatctgaacgtgtgg ctcgtctctctcaatctca cagatatgcctcttgatgtt gtgtacgaccaagttctttg catcaaagaagcctacacct
taccctgcaatctttgagat tcgccaaacctataatgca tcaacagggtgcatatctga accttgacatttacttccat ttgcatgcaaagagcaccaa
cgcgattgatctttgaacca cgaagaacagttggtgcct cacactcaacgcatcatcac agggcaaacattttagcacc acggattgagtgaaccttgt
ggtacatcttcaacacgcat atgttgcttctctccaaca attgagcagcaacacaaccg tggaattttaaccacgaccc cttcagattgtttgcagcag
tagtagatgatcgacgcctg taccctttcgcagatagag cgtaacgttctttgcactga cttggaaattggtcttggct ggaccaaactcttcagcaag
ggtgagtcttgttcttgatt ctccagactgctaagtcaa tgttttgatcctcttagcta tggattgtatttagcgcgac ggaactatatgctgcattgc
atgccaaagtccaaagggac tgactgatggagctcgggt ccggagtgagatagactgat cttagcgtggactctgtttg gtgggttgttaatcatctct
gttactgggggtgagaattc tgcttaatcactggaagcc acatcttcatctggcatttc ccattgttgagatcaactca tgcacgaagaatcgtcatcc
gacttttctgttgtctgtga gggatcttcagtttctgtg aagtagccacggagatatct cttgtccaagatttcttctc ttactggagcgagaagcgat
agtttctggtatgctcgata aaagctcatcggtacgctc catctcgcgattcaactcta tgtgaacattggcacctgaa gaacatgtgatctcggatcc
ccaatccttttacatgcatt agtagtttgtttggctgta gatgtctggaatacctctga aacgaactcgcagaccagat ctctgtctttagatgcagtt
gtgtagttttcatctcttct agtcagtggagtaactcct agcaaagcacgacgaactgc ttatgtatcgaacccactcg catcattttggccacgttaa
tggtgtgacccaacatagaa gttcatatgaaaccaccac cgagtgatagccatcagatg cagcatctgatctcgtaaga cgtatcatgttctccacaac
gcaagtggatcaaatgctgc   tcttcagcatctcatcattc   atcaacatctgggtcttcac
cacacctgattgcatatctt   atagctagggagctgaagtt   ttggagagcttgatttgcga
cttcattctccacatctttt   tgacactggtgaacgagcag   acacaattcgttgctgtctt
aaaggactagctccttgcaa   catcatgccttcatggtaag   cgcccaacgaacaaatcaca

Usage notes

ImageJ

Funding

Gatsby Charitable Foundation

John Innes Foundation

Biotechnology and Biological Sciences Research Council, Award: BBS/E/J/000PR9788

European Research Council, Award: 680324

Biotechnology and Biological Sciences Research Council, Award: BB/L025000/1

Biotechnology and Biological Sciences Research Council, Award: BB/N022572/1