Data from: dispersal restriction and facilitation in species with differing tolerance to development: a landscape genetics study of native and introduced lizards
Data files
May 03, 2024 version files 656.42 KB
-
Microsatellite_Genotypes.xlsx
55.93 KB
-
mtDNA_ANLI_16Jul20_FINAL.fas
99.79 KB
-
mtDNA_HEMA_16Jul20_FINAL.fas
108.84 KB
-
mtDNA_PHMA_16Jul20_FINAL.fas
98.48 KB
-
README.md
3.40 KB
-
Spatial_data.xlsx
289.98 KB
Abstract
Aim: The development of natural habitats into urban land uses has greatly accelerated in the recent past due to human activities. This habitat development disrupts species’ natural dispersal processes and can lead to both direct and indirect impacts on dispersal. Whether human activities result in restricted or facilitated dispersal may depend on a species’ development tolerance; however, this premise has not been tested. We examined the impact of urbanization and road networks on the dispersal of three lizard species in the context of their development tolerance.
Location: Curaçao
Methods: To quantify species’ development tolerance, we modelled three lizard species abundances at sites based on surrounding landscape development. Using microsatellite genotypes, we conducted individual-based resistance surface analyses and modelled the effect of habitat development on genetic admixture to assess indirect dispersal restriction and facilitation. We explored direct facilitation of dispersal using network analysis of mitochondrial haplotypes.
Results: Phyllodactylus martini, a native gecko species, was the least tolerant of development and experienced indirect dispersal restriction due to roads, according to resistance surface analyses. Anolis lineatus, a native anole species, exhibited a neutral relationship with development. Resistance surfaces and Structure analyses showed that A. lineatus faced indirect dispersal restrictions from roads and developed areas, while mitochondrial haplotype networks suggested they benefited from occasional human-facilitated long-distance dispersal events. Hemidactylus mabouia, an introduced gecko species, was the most tolerant of development, and experienced no dispersal restriction, but mitochondrial haplotypes suggest direct long-distance dispersal facilitation.
Main conclusions: Our findings highlight development tolerance as a key predictor of dispersal impact for these species and future work should test whether these patterns are upheld in other systems. Understanding how human activities affect species' dispersal will aid in managing introduced species while promoting connectivity for native species navigating dispersal challenges in dynamic landscapes.
README: Data from: dispersal restriction and facilitation in species with differing tolerance to development: a landscape genetics study of native and introduced lizards
https://doi.org/10.5061/dryad.w9ghx3fvz
This dataset includes genetic and spatial data relevant to three lizard species on the island of Curacao. Phyllodactylus martini is a native gecko, Anolis lineatus is a native anole, and Hemidactylus mabouia is an invasive gecko. Lizards were sampled at developed and undeveloped sites across the island. We genotyped all three species with at least 11 microsatellite markers and sequenced a section of mitochondrial DNA from cytochrome b.
Description of the data and file structure
Microsatellite_Genotypes.xlsx - contains microstallite genotypes for successfully amplified primers used in the final analysis for each lizard species (P. martini, A. lineatus, and H. mabouia). Each species is displayed on a separate sheet of Excel book. Genotypes are formatted with two columns per loci, each representing an allele. Each row represents a single individual. Missing data is indicated with a blank space. The site of collection is also included for each individual to facilitate joining of with spatial dataset (Spatial_data.xlsx). In addition, one sheet (primers) contains basic information on the primers used for each species. Additional information, such as amplification conditions, can be found in the supplemental materials of the associated paper.
Spatial_data.xlsx - contains spatial data relevant to sample locations across Curacao.
- Sites - contains spatial coordinates, information on lizard sampling effort, development context, and site type for each site at which lizards were sampled for genetic analysis. Also contains road density within nine buffers from 100-5000m around each sample point.
- Landcover_buffers - contains number of pixels within a given buffer (100-5000m) for each landcover category (water, cloud shadow, scrub, dense veg, high and low density development, and bare ground). Only scrub, dense vegetation, low-density development, and high-density development were used in landcover analyses. These buffers were calculated around each sampled individual.
The first sheet of each Excel file contains basic metadata on what is included within the file.
Cleaned mitochondrial sequences for each sequenced individual per species can be found in the .fas files. These sequences were cleaned and exported from the program MEGA; however, the .fas files can be opened using any text editing software, such as Notepad. We load the sequences in R using the haplotypes package. Species annotations, used in file names, are as follows:
- PHMA = P. martini
- ANLI = A. lineatus
- HEMA = H. mabouia
Sharing/Access information
Spatial data was derived from the following sources:
- landcover map of Curacao - Behm, J. E., Ellers, J., Jesse, W. A. M., Tran, T. J., & Helmus, M. R. (2023). Predicting and quantifying coexistence outcomes between resident and invading species using trait and abundance data (p. 2023.01.12.523647). bioRxiv. https://doi.org/10.1101/2023.01.12.523647
- road density - we extracted road line shapefiles from the OpenStreetMap dataset via the Humanitarian Data Exchange and rasterized them 100m resolution
Methods
Lizard surveys were conducted across the Caribbean Island of Curacao from January 27 - March 11, 2017. Tail tips were collected for DNA extraction from 100 Phyllodactylus martini, 100 Anolis lineatus, and 95 Hemidactylus mabouia.
Samples from P. martini and A. lineatus were genotyped with 11 new polymorphic microsatellite markers each (Genetic Marker Services, Hassocks, UK). See Supplemental materials of associated paper for marker details. We genotyped H. mabouia using 12 known polymorphic markers (Short & Petren, 2008). Mitochondrial DNA from cytochrome b was amplified using primers MTA-S:F (5’ ATCTCAGCATGATGAAACTTCG 3’) and MTF-S:R (5’ TTT GGTTTACAAGACCAATG 3’) for P. martini and A. lineatus (Thorpe et al., 2008) and primers rGlu-1L:F (5’ GAAAAACCRCCGTTGTWATTCAACTA 3’) and rPro-1H3:R (5’ TWAAAATKCTAGTTTTGGG 3’) for H. mabouia (Kumazawa & Endo, 2004).