Autophagy promotes protein degradation, and therefore has been proposed to maintain amino acid pools to sustain protein synthesis during metabolic stress. To date, how the autophagy pathway influences the protein translational landscape in mammalian cells remains unclear. Here, we utilize ribosome profiling to delineate the effects of genetic ablation of the autophagy regulator, ATG12, on protein translational control. In mammalian cells, genetic loss of autophagy does not impact global rates of cap dependent translation, even under starvation conditions. Instead, autophagy supports the translation of a subset of mRNAs with complex 5’UTR structures, enriched for cell cycle control and DNA damage repair. In particular, we demonstrate that autophagy enables the translation of the DNA damage repair protein BRCA2, which is functionally required to attenuate DNA damage and promote cell survival in response to PARP inhibition.  Overall, our findings illuminate a new role for autophagy directing the protein translational landscape.

Immortalized mouse embryonic fibroblasts of the genotype Atg12f/f;CagCreER+ were grown in DMEM supplemented with 10% serum. 5 days prior to the experiment, half of the cells were treated with 2uM 4-hydoxytamoxifen for three consecutive days to induce deletion of Atg12. 

Ribosome profiling experiments were performed using the ARTseq Ribosome profiling kit (Epicentre). Briefly, immortalized Atg12f/f or Atg12KO MEFs were maintained in control media (DMEM + 10% fetal bovine serum) or starved in HBSS for 2 hours. Following the starvation period, cycloheximide made fresh to 50mg/ml in Ethanol for each experiment was added at a final concentration of 100ug/ml.  Then, cells were collected in PBS and preparation of the samples was performed according the ARTseq Ribosome profiling kit manufacturer’s instructions. RNA extraction by Trizol LS (Ambion), rRNA depletion via RiboZero Gold (Epicentre), and quality and quantity of small RNA and DNA assayed using Agilent High Sensitivity Small RNA kit and DNA kit respectively (Agilent). 

Sequencing was performed at the UCSF sequencing core on Illumina HiSeq2000 as single reads at 150nt length, and analysis of reads was performed using Babel (Olshen et al, 2013) with alignment to mm10.protein_coding.ensembl_76. Subsequent analysis of the processed data was performed in R. 

Raw data: fastq files are named according to biological replicate, total RNA or RNA protected fragment, and condition. RPKK1-4 indicates which biological replicate the sequencing is from, Total indicates all RNA from the sample, RPF means ribosome protected fragment from the sample, 1-4 indicates condition where 1 = Atg12f/f in control media, 2 = Atg12f/f in starvation (HBSS2h), 3 = Atg12KO in control media, 4 = Atg12KO in starvation (HBSS2h). 

The adapter sequence is adapter: AGATCGGAAGAGCACACGTCT

Babel: For Babel analysis, the raw files are grouped by replicate and condition, and compared to each other by condition. Files were read into babel as follows:

- :sample_name: control_fed_1
  :rna:
    :inputs:
    - RPKK1Total1_S43_L006_R1_001.fastq.gz
    - RPKK1Total1_S59_L006_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK1RPF1_S39_L006_R1_001.fastq.gz
    - RPKK1RPF1_S55_L006_R1_001.fastq.gz

- :sample_name: control_fed_2
  :rna:
    :inputs:
    - RPKK2Total1_S31_L005_R1_001.fastq.gz
    - RPKK2Total1_S37_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK2RPF1_S27_L005_R1_001.fastq.gz
    - RPKK2RPF1_S33_L005_R1_001.fastq.gz

- :sample_name: control_fed_3
  :rna:
    :inputs:
    - RPKK3Total1_S23_L004_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK3RPF1_S19_L004_R1_001.fastq.gz

- :sample_name: control_fed_4
  :rna:
    :inputs:
    - RPKK4Total1_S35_L005_R1_001.fastq.gz
    - RPKK4Total1_S41_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK4RPF1_S47_L006_R1_001.fastq.gz
    - RPKK4RPF1_S63_L006_R1_001.fastq.gz

#2
- :sample_name: control_starved_1
  :rna:
    :inputs:
    - RPKK1Total2_S44_L006_R1_001.fastq.gz
    - RPKK1Total2_S60_L006_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK1RPF2_S40_L006_R1_001.fastq.gz
    - RPKK1RPF2_S56_L006_R1_001.fastq.gz

- :sample_name: control_starved_2
  :rna:
    :inputs:
    - RPKK2Total2_S32_L005_R1_001.fastq.gz
    - RPKK2Total2_S38_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK2RPF2_S28_L005_R1_001.fastq.gz
    - RPKK2RPF2_S34_L005_R1_001.fastq.gz

- :sample_name: control_starved_3
  :rna:
    :inputs:
    - RPKK3Total2_S24_L004_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK3RPF2_S20_L004_R1_001.fastq.gz

- :sample_name: control_starved_4
  :rna:
    :inputs:
    - RPKK4Total2_S36_L005_R1_001.fastq.gz
    - RPKK4Total2_S42_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK4RPF2_S48_L006_R1_001.fastq.gz
    - RPKK4RPF2_S64_L006_R1_001.fastq.gz

#3
- :sample_name: atg_minus_fed_1
  :rna:
    :inputs:
    - RPKK1Total3_S45_L006_R1_001.fastq.gz
    - RPKK1Total3_S61_L006_R1_001.fastq.gz
  :rp:
    :inputs:
    - JG01/RPKK1RPF3_S41_L006_R1_001.fastq.gz
    - JG01/RPKK1RPF3_S57_L006_R1_001.fastq.gz

- :sample_name: atg_minus_fed_2
  :rna:
    :inputs:
    - RPKK2Total3_S33_L005_R1_001.fastq.gz
    - RPKK2Total3_S39_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK2RPF3_S29_L005_R1_001.fastq.gz
    - RPKK2RPF3_S35_L005_R1_001.fastq.gz

- :sample_name: atg_minus_fed_3
  :rna:
    :inputs:
    - RPKK3Total3_S25_L004_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK3RPF3_S21_L004_R1_001.fastq.gz

- :sample_name: atg_minus_fed_4
  :rna:
    :inputs:
    - RPKK4Total3_S37_L005_R1_001.fastq.gz
    - RPKK4Total3_S43_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK4RPF3_S49_L006_R1_001.fastq.gz
    - RPKK4RPF3_S65_L006_R1_001.fastq.gz

#4
- :sample_name: atg_minus_starved_1
  :rna:
    :inputs:
    - RPKK1Total4_S46_L006_R1_001.fastq.gz
    - RPKK1Total4_S62_L006_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK1RPF4_S42_L006_R1_001.fastq.gz
    - RPKK1RPF4_S58_L006_R1_001.fastq.gz

- :sample_name: atg_minus_starved_2
  :rna:
    :inputs:
    - RPKK2Total4_S34_L005_R1_001.fastq.gz
    - RPKK2Total4_S40_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK2RPF4_S30_L005_R1_001.fastq.gz
    - RPKK2RPF4_S36_L005_R1_001.fastq.gz

- :sample_name: atg_minus_starved_3
  :rna:
    :inputs:
    - RPKK3Total4_S26_L004_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK3RPF4_S22_L004_R1_001.fastq.gz

- :sample_name: atg_minus_starved_4
  :rna:
    :inputs:
    - RPKK4Total4_S38_L005_R1_001.fastq.gz
    - RPKK4Total4_S44_L005_R1_001.fastq.gz
  :rp:
    :inputs:
    - RPKK4RPF4_S50_L006_R1_001.fastq.gz
    - RPKK4RPF4_S66_L006_R1_001.fastq.gz

:babel_tests:
- :babel_name: all_groups
  :groups:
  - :group_name: control_fed
    :samples: [ control_fed_1, control_fed_2, control_fed_3, control_fed_4 ]
  - :group_name: control_starved
    :samples: [ control_starved_1, control_starved_2, control_starved_3, control_starved_4 ]
  - :group_name: atg_minus_fed
    :samples: [ atg_minus_fed_1, atg_minus_fed_2, atg_minus_fed_3, atg_minus_fed_4 ]
  - :group_name: atg_minus_starved
    :samples: [ atg_minus_starved_1, atg_minus_starved_2, atg_minus_starved_3, atg_minus_starved_4 ]

autophagy_rp_orf.cov: shows number of read counts per mRNA identifier. columns are for each sample. 
 
control = Atg12f/f; atg_minus = Atg12KO
number indicates which biological replicate
.rna = total RNA ; .rp = RPF

autophagy_rp_qcsummary: provides quality control information for the sequencing and data analysis. Columns present data per sample. 

control = Atg12f/f; atg_minus = Atg12KO
number indicates which biological replicate
.rna = total RNA ; .rp = RPF

Reading the Babel outputs in R: see autophagy_rp_analysis.R. 

All statistical results comparing ribosome occupancy between conditions from Babel (between.babel analysis) are also presented as .csv files.

Column names: mRNA_logFC indicates mRNA fold change on log scale between conditions; mRNA_pval indicates significance of the mRNA change between conditions; pval indicates significance of ribosome occupancy change between conditions; FDR indicates false discovery rate of ribosome occupancy change between conditions; Direction indicates whether the ribosome occupancy was enriched or decreased between conditions. For Atg12ff_Fed_v_Atg12KO_Fed.csv and Atg12ff_starved_v_AtgKO_starved.csv: -1 = ribosome occupancy higher in Atg12KO; 1 = ribosome occupancy higher in Atg12f/f. For Atg12ff_Fed_v_Atg12ff_starved.csv: -1 = ribosome occupancy higher in starved than fed; 1 = ribosome occupancy higher in fed than starved