This folder contains experimental data associated with the investigation of the Smc3–Ddb1 pathway and its impact on zebrafish otic vesicle, hair cells, and kinocilia. The folder includes morphological measurements, hair cell phenotypes, kinocilium measurements, otolith phenotypes, qPCR data, neomycin experiments, and the generation and characterization of an Smc3 CRISPR mutant zebrafish line.

The datasets are organized into separate folders according to the experiment performed. Corresponding Excel files contain the measurements, observations, or analyses associated with the images and experimental groups.

---

General Injection Groups

The following injection groups are used throughout the relevant datasets:

SC refers to the standard control morpholino.
KD refers to knockdown.

For datasets containing multiple experimental groups of the same injection type, the groups are distinguished using numbers (e.g., 1, 2, 3, 4). These numbers correspond to the same group used in the associated Excel files when applicable.

N/A indicates that the corresponding information or measurement was not available, was not recorded, or was not applicable to that sample.

---

1. Body Size Measurements

• Body_size_phenotypes.zip

This folder contains images organized according to different morpholino injection treatments.

Each injection treatment folder may contain additional subfolders organized by the dates on which the images were captured.

Body Size Measurements

The corresponding Excel file contains body size measurements for the fish shown in the images.

Body size was measured from the head to the end of the tail, representing the full body length. If a fish was curved, the curved body was included in the measurement.

All body size measurements in the corresponding Excel file are reported in micrometers (µm).

Excel Organization

The Excel file contains multiple sheets, with each sheet corresponding to a different injection type.

If there are multiple groups of the same injection type, they are labeled with numbers (e.g., 1, 2, 3, 4). These numbers correspond to the same folder name in Excel, allowing each image group to be matched to its corresponding measurements.

Body Size Variables

• Name: Larvae were identified as SC KD or Smc3 KD, indicating whether they received a standard control (SC) or Smc3 (Smc3) morpholino injection at the one-cell stage. A number following the injection designation differentiates the sample from other samples receiving the same injection type.
• Minimum: The smallest body length measurement recorded for the larva, in µm.
• Maximum: The longest body length measurement recorded for the larva, in µm.
• Mean: The mean body length measurement, in µm.
• St Dev: Standard deviation of the body length measurements, in µm.

---

2. Eye Diameter Measurements

• Eye_size_phenotypes_.zip

This folder contains images organized according to the same morpholino injection treatments described above.

Each injection treatment folder may contain subfolders organized by the date on which images were captured.

Eye Diameter Measurements

The corresponding Excel file contains eye diameter measurements for the fish shown in the images.

Eye diameter was measured across the eye from one side to the other.

All eye diameter measurements in the corresponding Excel file are reported in micrometers (µm).

Excel Organization

The Excel file contains multiple sheets, with each sheet corresponding to a different injection type.

When there are multiple groups of the same injection type, they are numbered (e.g., 1, 2, 3, 4). The numbering corresponds to the same group used in the Excel file.

Eye Size Variables

• Name: Larvae were identified as SC KD or Smc3 KD, indicating whether they received a standard control (SC) or Smc3 (Smc3) morpholino injection at the one-cell stage. A number following the injection designation differentiates the sample from other samples receiving the same injection type.
• Minimum: The smallest eye diameter measurement recorded, in µm.
• Maximum: The largest eye diameter measurement recorded, in µm.
• Mean: The mean eye diameter measurement, in µm.
• St Dev: Standard deviation of the eye diameter measurements, in µm.

---

3. Hair Cell Phenotypes

• Hair_cell_phenotypes_.zip

This folder contains images and data documenting hair cell phenotypes following immunofluorescence (IF) staining.

Immunofluorescence and Imaging

The images were captured following immunofluorescence staining using an anti-HCS primary antibody to visualize hair cells.

Some images also contain the DAPI channel.

Images were acquired using confocal microscopy and are saved as CZI files.

Hair Cell and Neuromast Measurements

Hair cells were counted in specific neuromasts, including:

• MI1
• MI2
• O2
• M2
• IO4
• P1 (included in some datasets)

The Excel file contains the hair cell counts for these neuromasts, as well as an average hair cell count calculated from the measured neuromasts.

Not all neuromasts and hair cells counted in the Excel file are included in the image folders. Only a subset were imaged for representative purposes.

Hair Cell Count Variables

• MI1: Number of hair cells observed in the middle 1 neuromast.
• MI2: Number of hair cells observed in the middle 2 neuromast.
• O2: Number of hair cells observed in the otic 2 neuromast.
• M2: Number of hair cells observed in the mandibular 2 neuromast.
• IO4: Number of hair cells observed in the infraorbital 4th neuromast.
• Average: Average number of hair cells observed across the five evaluated neuromasts (MI1, MI2, O2, M2, and IO4) for each larva.

Hair cell counts are reported as numbers of cells and therefore do not have a unit of measurement.

Folder and Excel Organization

Each main folder corresponds to a specific injection group.

When multiple groups of the same injection type are present, they are numbered (e.g., 1, 2, 3, 4).

Some folders may also contain subfolders organized by imaging date.

---

4. Kinocilium Images and Length Measurements

• Kinocilia_phenotypes.zip

This folder contains images of kinocilia from the P1 neuromast and lateral line neuromasts.

The images are CZI confocal files acquired following an immunofluorescence (IF) staining experiment.

Immunofluorescence Staining

Kinocilia were labeled using acetylated tubulin, which was used to visualize and measure kinocilium length.

The fish were also stained with DAPI.

In some experiments, an additional actin stain was performed.

Therefore, images may contain:

• Two channels: acetylated tubulin + DAPI
• Three channels: acetylated tubulin + DAPI + actin

Not all images contain the actin channel.

Folder and Excel Organization

The same injection groups and concentrations described in the general injection section apply to this dataset.

The Excel file contains multiple sheets corresponding to different injection groups.

Folders may contain multiple subfolders corresponding to different imaging dates. These dates correspond to the dates listed in the Excel file.

The exact folder names correspond to the corresponding Excel sheet names.

Kinocilium Length Measurement

CZI files were imported into Fiji for analysis.

The 647 channel, which was used to detect acetylated tubulin, was used to evaluate kinocilium length.

For each kinocilium, the x-, y-, and z-slice coordinates were recorded for both the base and tip of the kinocilium.

Coordinate Measurements

The following measurements are recorded in the Excel file:

• First X: X-coordinate of the first optical slice in which the relevant axis labeling appears.
• First Y: Y-coordinate of the first optical slice in which the relevant axis labeling appears.
• Last X: X-coordinate of the last optical slice in which the relevant axis labeling appears.
• Last Y: Y-coordinate of the last optical slice in which the relevant axis labeling appears.
• Z thickness: Thickness of each optical slice (voxel depth).

The X- and Y-displacements between the base and tip of the kinocilium were calculated as the differences between the corresponding X and Y coordinates.

The 2D displacement was estimated as the hypotenuse of a right triangle formed by the X-displacement and Y-displacement.

The Z-displacement was calculated by multiplying the number of optical z-slices between the kinocilium tip and base by the thickness of each z-slice.

The final kinocilium (axoneme) length was estimated as the hypotenuse of a right triangle formed by the 2D displacement and Z-displacement:

Kinocilium length = √(2D displacement² + Z-displacement²)

This calculation accounts for displacement in all three dimensions.

---

5. Otolith Phenotypes

• Otolith_phenotypes.zip

This folder contains images of otic vesicles (OV) from 3 dpf (days post-fertilization) fish.

The folder contains two corresponding Excel files:

• OV Phenotypes
• Otolith Measurements

The same injection groups and concentrations described in the general injection section apply to this dataset.

OV Phenotypes

The OV Phenotypes Excel file contains qualitative observations of the otoliths rather than quantitative measurements.

The following phenotypes are reported:

These categories describe the number and appearance of the otolith observed.

Otolith Measurements

The Otolith Measurements Excel file contains quantitative measurements from the same injection groups.

All otolith measurements are reported in micrometers (µm).

The Info sheet defines the abbreviations used for the measurements:

• AOD: Anterior otolith diameter
• POD: Posterior otolith diameter
• OD: Distance between the two otoliths
• CD: Cochlear diameter

The Excel file contains four measurement sheets. Each sheet contains multiple injection groups and their corresponding measurements.

Otolith Measurement Variables

For the quantitative otolith measurements:

• Minimum: The smallest measurement recorded for the corresponding otolith variable, in µm.
• Maximum: The largest measurement recorded for the corresponding otolith variable, in µm.
• Mean: The mean measurement for the corresponding otolith variable, in µm.
• St Dev: Standard deviation of the measurements for the corresponding otolith variable, in µm.

Matching Folders to Excel Data

The injection group names listed in the Excel sheets correspond to the associated image folders.

For example, a group listed as SC knockdown folder 1 in the Excel file corresponds to the associated Control Knockdown 1 image folder.

The folder name listed in the Excel file should therefore be used to identify the location of the corresponding images.

---

6. qPCR Data

• qPCR.zip

This folder contains three Excel files corresponding to separate qPCR experiments. Each experiment contains two biological replicates.

The same injection groups are used across the experiments.

Injection Groups

SC refers to the standard control morpholino.

Genes Analyzed

The experimental genes analyzed by qPCR are:

• CP110
• dnha9

The reference/control genes are:

• keratin4
• ef-1a

Primer Sequences

keratin4

• Forward: 5′-TCATCGACAAAGTGCGCTTC-3′
• Reverse: 5′-TCGATGTTGGAACGTGTGGT-3′

CP110

• Forward: 5′-GCAGATGATCCGACAGGACC-3′
• Reverse: 5′-CAGCTTCCCTTTAGGGTGCG-3′

dnha9

Primers from PMID: 23858445:

• Forward: 5′-GAGCATCAGAGGAGCAAGCA-3′
• Reverse: 5′-AGCGGTGTTGTAGGAACGAG-3′

ef-1a

• Forward: 5′-CTGGTTCAAGGGATGGAAGA-3′
• Reverse: 5′-GGTACAGTTCCAATACCTCCA-3′

qPCR Data and Analysis

The Excel files contain the Ct values and calculations used for qPCR analysis.

For each sample:

1. Ct values from two technical replicates are recorded.
2. The average Ct of the two technical replicates is calculated.
3. ΔCt is calculated from the average Ct values.
4. ΔΔCt is calculated using the appropriate control.
5. The resulting differences are reported for comparison between experimental and control groups.

Ct refers to the cycle threshold value obtained during quantitative PCR.

ΔCt refers to the difference between the Ct value of the target gene and the Ct value of the reference gene.

ΔΔCt refers to the difference between the ΔCt of the experimental sample and the ΔCt of the appropriate control.

Controls

NTC (No Template Control) is included as a control to monitor for contamination or nonspecific amplification.

Keratin4 and ef-1a were used as reference/control genes for normalization of gene expression, depending on the experiment.

Biological Replicates

Each Excel file represents a separate qPCR experiment and contains two biological replicates. The biological replicates are maintained separately so that the experiments can be evaluated independently.

---

7. Neomycin Treatment and Neuromast Analysis

• Neomycin_uptake_phenotypes.zip

This folder contains images and corresponding data from a neomycin-induced hair cell damage experiment.

Injection Groups

The injection groups included are:

• Smc3 knockdown + Ddb1 mRNA
• Ddb1 knockdown (Ddb1-KD)

Neomycin Treatment

5 dpf larvae were placed in Petri dishes containing either:

• 50 mL of 200 μM neomycin in sterile embryo medium (EM), or
• 50 mL of EM (embryo medium) as the control.

Larvae were incubated for 30 minutes at 28°C.

Following treatment, larvae were washed three times for 5 minutes each in EM at 28°C and then allowed to recover for 1 hour at 28°C in sterile EM.

DASPEI Staining

Following recovery, embryos were incubated in 80 μg/mL DASPEI (2-[4-(dimethylamino) styryl]-N-ethylpyridinium iodide) at room temperature for 30 minutes.

DASPEI was used to label the neuromasts for visualization.

Imaging

Larvae were imaged at 4× magnification using a Nikon Eclipse 80i microscope equipped with a SPOT-RTKE digital camera and SPOT software.

An X-Cite 120 Fluorescence Imaging System was used as the fluorescent light source.

Multiple images were captured for each fish at different focal planes to ensure visualization of all stained neuromasts, since not all neuromasts were necessarily in focus within the same plane.

For representative images, saturation and brightness were increased to assist with neuromast visualization.

Folder Organization

The experiment contains two main folders corresponding to two different experimental dates.

Within each date folder:

Date → Injection Treatment → Individual Fish → Images

Each injection treatment contains a separate folder for each individual fish, and each fish folder contains multiple images captured at different focal planes.

Excel File

The corresponding Excel file contains the number of neuromasts observed for each fish.

Each Excel sheet corresponds to a different injection treatment. The neuromast counts can therefore be matched to the corresponding injection group and individual fish in the image folders.

---

8. Smc3 CRISPR Line Generation and Characterization

• Smc3_crispants.zip

This folder contains the documentation, sequencing data, protein sequence analysis, and genotyping results associated with the generation and characterization of the Smc3 CRISPR mutant zebrafish line.

The folder documents the CRISPR target and guide RNA design, sequencing and genotyping primers, sequencing results, predicted wild-type and mutant protein sequences, raw sequencing reads, and gel-based screening of the F0, F1, and F2 generations.

CRISPR Target and Guide RNA

The CRISPR guide RNA used to target Smc3 is:

gRNA: GGTGTCAAAGAACTTCAGCGAGG

Guide RNA location: chr22:29863939

The wild-type CDS used for sequence analysis is:

ENSDART00000019786.9

Genotyping and Sequencing Primers

The genotyping/PCR primers are:

• Left primer: CGATAGACATGAGATCAACACCA
• Right primer: CAGTGTCACCCTTCTTCATCAC

The sequencing primer is:

• Sequencing primer: CGATAGACATGAGATCAACACCA

Sequencing primer location: chr22:29864062–29864085

The CRISPR target sequence, primer sequences, and their genomic locations are also documented in the accompanying Word document.

Sequencing Results

Sequencing was performed on haploid embryos obtained from two different strains:

• 1752
• 1753

The sequencing results showed that strain 1752 did not contain the targeted mutation, whereas strain 1753 contained a frameshift mutation.

The mutation identified in strain 1753 consists of:

• 7-bp deletion: TCAGCGA
• 11-bp insertion: AGAAGCTGGTG

The combination of the deletion and insertion results in a frameshift mutation in the Smc3 sequence.

The sequencing results and their interpretation are described in the accompanying Word document.

Wild-Type and Mutant Protein Sequences

A separate Word document contains the predicted wild-type Smc3 protein sequence and the mutant protein sequence resulting from the identified mutation.

The mutant sequence begins to differ from the wild-type sequence following the region affected by the CRISPR-induced mutation. The document identifies the point at which the amino acid sequence begins to change and provides the resulting mutant protein sequence.

The mutant DNA sequence is also provided in the document, with the newly occurring stop codons identified.

Smc3 Haploid Sequencing

The Smc3 haploid sequencing folder contains the raw sequencing data generated during characterization of the Smc3 CRISPR line.

The sequencing reads are available in multiple formats, including:

• AB1 files
• TXT files
• PDF files

The sequencing files correspond to the two strains, 1752 and 1753. The number following the strain designation corresponds to the individual embryo that was sequenced.

For example, sequencing files beginning with 1752 or 1753 identify the strain, while the following number identifies the individual embryo.

Gel Images

The gel images folder contains PDF files documenting the genotyping screens performed during different generations of the Smc3 line.

The screening includes:

• F0
• F1
• F2

These gel images document the PCR/genotyping screening used to identify and track the Smc3 allele through successive generations.

---

Overall Folder Organization

The project folder is organized into individual experimental datasets. Each dataset contains the relevant image files, Excel files, and supporting documentation needed to interpret the experiment.

Where applicable:

• Image folders contain the raw or representative microscopy images.
• Excel files contain the associated measurements, counts, observations, or calculations.
• Each measurement Excel sheet corresponds to an injection type, where applicable.
• Folder names correspond to experimental groups and, when specified, match the corresponding Excel sheet names.
• Numbered groups distinguish multiple experimental groups of the same injection type.
• Dates identify separate imaging or experimental sessions.
• CZI files are confocal microscopy files.
• PDF, AB1, and TXT files in the Smc3 sequencing dataset contain sequencing and genotyping data.
• N/A indicates that information or a measurement was unavailable, was not recorded, or did not apply to the corresponding sample.

Together, these datasets document the phenotypic, molecular, and genetic characterization of the SMC3/Ddb1-related zebrafish experiments, as well as the generation and validation of the Smc3 CRISPR mutant line.