Data from: Multi-omic analyses identify molecular targets of Chd7 that mediate CHARGE syndrome model phenotypes
Data files
Sep 17, 2025 version files 9.44 MB
-
3dpf_WTHTMUT_raw_prot.xlsx
2.60 MB
-
3dpf_WTHTMUT_raw_rna_counts.csv
2.07 MB
-
5dpf_WTHTMUT_raw_prot.xlsx
2.69 MB
-
5dpf_WTHTMUT_raw_rna_counts.csv
2.07 MB
-
README.md
16.20 KB
Abstract
Dataset DOI: 10.5061/dryad.2v6wwq01t
Description of the data and file structure
These datasets include the raw data and links to packages and code needed to reproduce the analysis performed in Hancock et al 2025 (biorxiv). The goal of this study was to identify a set of candidate genes that link loss of chd7 with disease-related phenotypes. All the data was collected from chd7 Wild Type (WT), Heterozygous (HT), and homozygous mutant (MUT) zebrafish head tissue at 3 days post fertilization (dpf) and 5 dpf each with 4 biological replicates. We dissected heads from tails and used tail tissue to genotypes ensuring the same number (n = ~10-40) of pooled heads. Two of the datasets (rna) are raw counts from bulk RNA sequencing data, and the other two datasets (prot) are pre-analyzed proteomics mass spectrometry data performed by METRIC at NCSU. Missing values are denoted with "n/a" (not available).
Files and variables
File: 3dpf_WTHTMUT_raw_rna_counts.csv
Description: 3 days post fertilization (dpf), chd7 Wild Type (WT), heterozygous (HT), and homozygous mutant (MUT), raw RNA sequencing count data.
Variables
- GENE: Ensembl Danio rerio gene identifier
- HT31: chd7 heterozygous (HT), 3 days post fertilization (dpf), replicate 1
- HT32: chd7 heterozygous (HT), 3 days post fertilization (dpf), replicate 2
- HT33: chd7 heterozygous (HT), 3 days post fertilization (dpf), replicate 3
- HT34: chd7 heterozygous (HT), 3 days post fertilization (dpf), replicate 4
- MUT31: chd7 homozygous mutant (MUT), 3 days post fertilization (dpf), replicate 1
- MUT32: chd7 homozygous mutant (MUT), 3 days post fertilization (dpf), replicate 2
- MUT33: chd7 homozygous mutant (MUT), 3 days post fertilization (dpf), replicate 3
- MUT34: chd7 homozygous mutant (MUT), 3 days post fertilization (dpf), replicate 4
- WT31: chd7 Wild Type (WT), 3 days post fertilization (dpf), replicate 1
- WT32: chd7 Wild Type (WT), 3 days post fertilization (dpf), replicate 2
- WT33: chd7 Wild Type (WT), 3 days post fertilization (dpf), replicate 3
- WT34: chd7 Wild Type (WT), 3 days post fertilization (dpf), replicate 4
File: 3dpf_WTHTMUT_raw_prot.xlsx
Description: 3 days post fertilization (dpf), chd7 Wild Type (WT), heterozygous (HT), and homozygous mutant (MUT), pre-analyzed proteomics mass spectrometry data.
Variables
- Checked: Whether the protein entry was selected manually by the user in the interface (Proteome Discoverer)
- Protein FDR Confidence: Combined: Overall confidence level assigned by the Protein FDR Validator
- Master Accession: The representative protein in a protein group unique identifier
- Description: Human-readable protein name without the accession code
- Exp. q-value: Combined: The minimum false discovery rate at which this protein would be included, set to 0.05
- Contaminant: Prescence of contaminants using a custom contaminants database to identify presence of human keratin and reagent enzyme peptides
- Marked as: Database of protein group unique identifier
- Sum PEP Score: Aggregate score per protein computed from the PEP (Posterior Error Probability) values
- Coverage [%]: Percentage of the full protein sequence that is covered by identified peptides
- # Peptides: Distinct peptide sequences matched to the protein
- # PSMs: Total number of peptide-spectrum matches
- # Unique Peptides: Peptides unique to this protein or group
- # AAs: Sequence length in amino acids
- MW [kDa]: Calculated molecular weight (without PTMs)
- calc. pI : theoretical isoelectric point
- Score: Sequest HT: Sequest HT: The protein-level score derived by summing the top XCorr peptide scores via the Sequest HT search engine
- Abundance Ratio: (3dpfHT) / (3dpfWT): fold‑change
- Abundance Ratio: (3dpfMU) / (3dpfWT): fold‑change
- Abundance Ratio P-Value: (3dpfHT) / (3dpfWT): P‑value
- Abundance Ratio P-Value: (3dpfMU) / (3dpfWT): P‑value
- Abundance Ratio Adj. P-Value: (3dpfHT) / (3dpfWT) : FDR corrected P‑value
- Abundance Ratio Adj. P-Value: (3dpfMU) / (3dpfWT): FDR corrected P‑value
- Abundances (Grouped): 3dpfHT: Mean abundance across replicates for each group
- Abundances (Grouped): 3dpfMU: Mean abundance across replicates for each group
- Abundances (Grouped): 3dpfWT: Mean abundance across replicates for each group
- Abundances (Grouped) CV [%]: 3dpfHT: Coefficient of variation across replicates within each group
- Abundances (Grouped) CV [%]: 3dpfMU: Coefficient of variation across replicates within each group
- Abundances (Grouped) CV [%]: 3dpfWT: Coefficient of variation across replicates within each group
- Found in Sample: [S3] F3: Sample, 3dpfHT, 9: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S6] F6: Sample, 3dpfHT, 10: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S9] F9: Sample, 3dpfHT, 11: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S12] F12: Sample, 3dpfHT, 12: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S4] F4: Sample, 3dpfMU, 17: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S7] F7: Sample, 3dpfMU, 18: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S10] F10: Sample, 3dpfMU, 19: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S13] F13: Sample, 3dpfMU, 20: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S5] F5: Sample, 3dpfWT, 1: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S8] F8: Sample, 3dpfWT, 2: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S11] F11: Sample, 3dpfWT, 3: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S14] F14: Sample, 3dpfWT, 4: Marking presence in each individual sample by confidence corresponding to high/medium/low
- # Peptides (by Search Engine): Sequest HT: Identified peptides from protein databases
- Biological Process: Inferred biological process annotations from integrated databases
- Cellular Component: Inferred cellular component annotations from integrated databases
- Molecular Function: Inferred molecular function annotations from integrated databases
- Pfam IDs: Protein family assignment
- Entrez Gene ID: Gene identifier
- Gene Symbol Gene ID: Gene identifier
- Ensembl Gene ID: Gene identifier
- Reactome Pathways: Mapped to curated pathway database Reactome Pathways
- WikiPathways: Mapped to curated pathway database WikiPathways
- # Protein Pathway Groups: Count of pathway clusters associated with that protein
- # Razor Peptides: Peptides shared among proteins but assigned to the one with most peptide support per parsimony rules
- # Protein Groups: Number of protein groups in which that protein appears
- Modifications: Lists post‑translational modifications observed in the protein
File: 5dpf_WTHTMUT_raw_rna_counts.csv
Description: 5 days post fertilization (dpf), chd7 Wild Type (WT), heterozygous (HT), and homozygous mutant (MUT), pre-analyzed proteomics mass spectrometry data.
Variables
- GENE: Ensembl Danio rerio gene identifier
- HT51: chd7 heterozygous (HT), 5 days post fertilization (dpf), replicate 1
- HT52: chd7 heterozygous (HT), 5 days post fertilization (dpf), replicate 2
- HT53: chd7 heterozygous (HT), 5 days post fertilization (dpf), replicate 3
- HT54: chd7 heterozygous (HT), 5 days post fertilization (dpf), replicate 4
- MUT51: chd7 homozygous mutant (MUT), 5 days post fertilization (dpf), replicate 1
- MUT52: chd7 homozygous mutant (MUT), 5 days post fertilization (dpf), replicate 2
- MUT53: chd7 homozygous mutant (MUT), 5 days post fertilization (dpf), replicate 3
- MUT54: chd7 homozygous mutant (MUT), 5 days post fertilization (dpf), replicate 4
- WT51: chd7 Wild Type (WT), 5 days post fertilization (dpf), replicate 1
- WT52: chd7 Wild Type (WT), 5 days post fertilization (dpf), replicate 1
- WT53: chd7 Wild Type (WT), 5 days post fertilization (dpf), replicate 1
- WT54: chd7 Wild Type (WT), 5 days post fertilization (dpf), replicate 1
File: 5dpf_WTHTMUT_raw_prot.xlsx
Description:
Variables
- Checked: Whether the protein entry was selected manually by the user in the interface (Proteome Discoverer)
- Protein FDR Confidence: Combined: Overall confidence level assigned by the Protein FDR Validator
- Master Accession: The representative protein in a protein group unique identifier
- Description: Human-readable protein name without the accession code
- Exp. q-value: Combined: The minimum false discovery rate at which this protein would be included, set to 0.05
- Contaminant: Prescence of contaminants using a custom contaminants database to identify presence of human keratin and reagent enzyme peptides
- Marked as: Database of protein group unique identifier
- Sum PEP Score: Aggregate score per protein computed from the PEP (Posterior Error Probability) values
- Coverage [%]: Percentage of the full protein sequence that is covered by identified peptides
- # Peptides: Distinct peptide sequences matched to the protein
- # PSMs: Total number of peptide-spectrum matches
- # Unique Peptides: Peptides unique to this protein or group
- # AAs: Sequence length in amino acids
- MW [kDa]: Calculated molecular weight (without PTMs)
- calc. pI : theoretical isoelectric point
- Score: Sequest HT: Sequest HT: The protein-level score derived by summing the top XCorr peptide scores via the Sequest HT search engine
- Abundance Ratio: (5dpfHT) / (5dpfWT): fold‑change
- Abundance Ratio: (5dpfMU) / (5dpfWT): fold‑change
- Abundance Ratio P-Value: (5dpfHT) / (5dpfWT): P‑value
- Abundance Ratio P-Value: (5dpfMU) / (5dpfWT): P‑value
- Abundance Ratio Adj. P-Value: (5dpfHT) / (5dpfWT) : FDR corrected P‑value
- Abundance Ratio Adj. P-Value: (5dpfMU) / (5dpfWT): FDR corrected P‑value
- Abundances (Grouped): 5dpfHT: Mean abundance across replicates for each group
- Abundances (Grouped): 5dpfMU: Mean abundance across replicates for each group
- Abundances (Grouped): 5dpfWT: Mean abundance across replicates for each group
- Abundances (Grouped) CV [%]: 5dpfHT: Coefficient of variation across replicates within each group
- Abundances (Grouped) CV [%]: 5dpfMU: Coefficient of variation across replicates within each group
- Abundances (Grouped) CV [%]: 5dpfWT: Coefficient of variation across replicates within each group
- Found in Sample: [S15] F15: Sample, 5dpfHT, 13: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S18] F18: Sample, 5dpfHT, 14: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S21] F21: Sample, 5dpfHT, 15: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S24] F24: Sample, 5dpfHT, 16: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S16] F16: Sample, 5dpfMU, 21: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S19] F19: Sample, 5dpfMU, 22: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S22] F22: Sample, 5dpfMU, 23: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S25] F25: Sample, 5dpfMU, 24: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S17] F17: Sample, 5dpfWT, 5: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S20] F20: Sample, 5dpfWT, 6: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S23] F23: Sample, 5dpfWT, 7: Marking presence in each individual sample by confidence corresponding to high/medium/low
- Found in Sample: [S26] F26: Sample, 5dpfWT, 8: Marking presence in each individual sample by confidence corresponding to high/medium/low
- # Peptides (by Search Engine): Sequest HT: Identified peptides from protein databases
- Biological Process: Inferred biological process annotations from integrated databases
- Cellular Component: Inferred cellular component annotations from integrated databases
- Molecular Function: Inferred molecular function annotations from integrated databases
- Pfam IDs: Protein family assignment
- Entrez Gene ID: Gene identifier
- Gene Symbol Gene ID: Gene identifier
- Ensembl Gene ID: Gene identifier
- Reactome Pathways: Mapped to curated pathway database Reactome Pathways
- WikiPathways: Mapped to curated pathway database WikiPathways
- # Protein Pathway Groups: Count of pathway clusters associated with that protein
- # Razor Peptides: Peptides shared among proteins but assigned to the one with most peptide support per parsimony rules
- # Protein Groups: Number of protein groups in which that protein appears
- Modifications: Lists post‑translational modifications observed in the protein
Code/software
RNA sequencing demultiplexed reads were analyzed using the NCSU Bioinformatics Resource Center (BRC) computing cluster and SLURM commands can be found at https://github.com/melody-create. Quality Control was done with FastQC. Adapter trimming and quality filtering was done with Fastp. An indexed reference was built using GRCz11.fna and GRCz11.gtf input ensembl.org/info/data/ftp/index.html. Paired end sample reads were aligned with STAR aligner. Differential expression analysis of un-normalized counts was done with DESeq2. All RNA sequencing p-values calculated by Wald test in DESeq2.
All transcriptomic and proteomic data was plotted using R packages and tools and the R code can be found at https://github.com/melody-create/Transcriptomic-Analysis (R version 4.3.3). Principal component analysis was done using DESeq2 (Love et al., 2014) for transcriptomic data and Proteome Discoverer for proteomic data code can be found at https://github.com/melody-create/Transcriptomic-Analysis/blob/main/R_Deseq2_scripts. Heatmaps were made using Complex Heatmap (Gu et al., 2016) (Gu, 2022) code can be found at https://github.com/melody-create/Transcriptomic-Analysis/blob/main/R_heatmaps. RNAs and proteins from heatmap slices were analyzed for gene ontology using the PANTHER 19.0 Overrepresentation Test at https://pantherdb.org/webservices/go/overrep Danio rerio (all genes in database), GO biological process complete, Fisher's Exact test, False Discovery Rate correction (https://geneontology.org/). Volcano plots were made using Enhanced Volcano (Blighe, K, S Rana, and M Lewis, 2018) code can be found at https://github.com/melody-create/Transcriptomic-Analysis/blob/main/R_volcanoplots. Raw data from Qiagen Ingenuity Pathway Analysis (IPA) canonical pathways, upstream regulators, and diseases and functions was plotted using ggplot and Complex Heatmap code can be found at https://github.com/melody-create/Transcriptomic-Analysis/blob/main/R_stacked_pathway.
Materials and Methods
Danio rerio husbandry and maintenance
All animal use and procedures were approved by and in accordance with the North Carolina State University Institutional Animal Care and Use Committee (IACUC) guidelines. All chd7 Wild Type (WT), Heterozygous (HT), and Homozygous mutant (MUT), and all candidate gene crispants used were of the Tüpfel long fin (TLF) background. The TLF strain originated from Zebrafish International Resource Center (ZIRC) stocks. Adult zebrafish were housed in 5 fish/L density under a 14 h:10 h light:dark cycle at ~28°C, and were fed rotifers, Artemia brine shrimp (Brine Shrimp Direct), and GEMMA micro 300 (Skretting).
To generate embryos for larval testing, male and female pairs were placed in mating boxes (Aquaneering) containing system water and artificial grass. 1–2 h into the subsequent light cycle of the following day, embryos were collected and placed into petri dishes containing 1× E3 embryo media. Embryos were sorted for fertilization under a dissecting scope at ~6 h post fertilization (hpf) and placed into 10 cm petri dishes with n ≤ 65. All embryos were reared in a temperature‐controlled incubator at 29°C on a 14 h:10 h light:dark cycle. Each day until testing, a 50%–75% media change was performed.
Zebrafish model of CHARGE syndrome
In this study we use a previously characterized zebrafish model of CHARGE syndrome (Hodorovich et al., 2023). CRISPR-Cas9 gene editing induced a 7 bp frameshift deletion that leads to a premature stop codon in exon 9 of chd7.
Dissections
Larvae were anesthetized at 3 days post fertilization (dpf) or 5 dpf zebrafish with ice cold E3. Dissections were performed under a dissecting microscope with scalpel and forceps. A scalpel was used to cut diagonally to include all brain tissue and exclude yolk. Head tissue was rinsed in 1 X PBS and then placed in RNA later (RNA) or 1 X PBS (protein) for long term storage. Head tissue in RNA later was placed on ice for 20 mins, 4C for 24 hours, and then -20C for long term storage based on manufacturer protocol. The corresponding tail tissue was placed in Methanol for subsequent genotyping. Genotyping was done by prepping DNA from tail tissue using Hotshot DNA extraction. Then that DNA was used in a PCR reaction with GoTaq DNA polymerase and primer pair forward: GATGATGAGCCCTTCAACCCAG and reverse: CAGATGGTTTGAGAACGATTGA. PCR reactions were visualized using gel electrophoresis with 50 bp ladder where wild type bands are 132 bp and mutant bands are 125 bp.
Transcriptomics
RNA isolation
Once genotypes were known, head tissue was pooled based on genotype, 40 heads for 3 dpf and 20 heads for 5 dpf, using a glass pasteur pipette into a 1.5 mL tube then stored at -20C until ready for isolation. For RNA isolation New England Biolabs Monarch Total RNA miniprep kit and protocol were used. Follow “Part 1: Sample disruption and homogenization” and “Part 2: RNA binding and elution” for tissue up to 10mg. RNA concentration was determined using an Implen NanoPhotometer and then sent to the North Carolina State University Genomic Sciences Laboratory (GSL) for 250 bp paired end sequencing on the Illumina Novaseq.
RNA-sequencing analysis
Demultiplexed reads were analyzed using the NCSU Bioinformatics Resource Center (BRC) computing cluster and SLURM commands can be found at https://github.com/melody-create. Quality Control was done with FastQC. Adapter trimming and quality filtering was done with Fastp. An indexed reference was built using GRCz11.fna and GRCz11.gtf input ensembl.org/info/data/ftp/index.html. Paired end sample reads were aligned with STAR aligner. Differential expression analysis of un-normalized counts was done with DESeq2. All RNA-sequencing p-values calculated by Wald test in DESeq2.
Proteomics
Protein isolation
Once genotypes were known, head tissue was pooled based on genotype, 20 heads for 3 dpf and 10 heads for 5 dpf, using a glass pasteur pipette into a 1.5 mL tube then stored at -20C until ready for isolation. For protein isolation tissue was suspended in a 100 µL solution of 50 mM ammonium bicarbonate (pH 8.0) containing 1% Sodium deoxycholate (SDC). Samples were lysed by probe sonication via 2 pulses at 20 seconds per pulse at a 20% amplitude setting. Cellular debris was removed via centrifugation at 10,000 RPM for 5 minutes at 4C. Supernatant was retained with pipette on ice and assessed for protein quantification by bicinchoninic acid (BCA) assay using the Pierce BCA Protein Assay Kit. The standard curve was used to determine protein concentration of each unknown sample.
Materials
The following materials were purchased from Thermo Fisher Scientific (Wilmington, DE): 1 M tris hydrochloride solution pH 7.5, 1 M tris hydrochloride solution pH 8, sodium chloride, ammonium bicarbonate (ABC), Pierce™ Mass Spec Grade trypsin, Pierce™ BCA Protein Assay, Pierce™ Quantitative Colorimetric Peptide Assay, LC/MS grade water, LC/MS grade acetonitrile, LC/MS grade formic acid, and Vivicon 30 kD molecular weight cutoff filters. Urea, dithiothreitol (DTT), and iodoacetamide (IAA) were purchased from Bio-Rad (Hercules, CA). Sodium deoxycholate (SDC) and calcium chloride, were purchased from MilliporeSigma (St. Louis, MO).
Filter Aided Sample Preparation (FASP)
Isolated protein was reconstituted into 50 mM ABC, 1% SDC and a 200 uL aliquot precipitated and rinsed with 800 uL ice-cold acetone. Protein was allowed to precipitate for 30 min at -20 °C. After centrifugation acetone was decanted and removed entirely by vacuum evaporation. Rinsed protein was reconstituted again in 50 mM ABC, 1% SDC and the concentration measured by Pierce™ BCA Protein Assay. A 200 uL volume of each sample containing about 27 µg protein was incubated with 15 μL of 50 mM DTT at 56 °C for 30 min. Samples were transferred to Vivicon 30 kD filters and washed with 8 M urea in 0.1M TRIS-HCl pH 8. Cysteines were alkylated with 64 μL of 200 mM iodoacetamide and incubation at room temperature in the dark for 1 hr. Samples were rinsed 3 times with 2 M urea, 10 mM CaCl2 in 0.1M Tris-HCl pH 8, then 3 times with 0.1M Tris-HCl pH 7. All rinsates were discarded. Trypsin protease solution was added to reach a 1:25::trypsin:protein ratio, and samples were incubated overnight at 37 °C. Amounts of recovered peptides were quantified by Pierce™ Quantitative Colorimetric Peptide Assay. Samples were evaporated to dryness in a vacuum concentrator and reconstituted in 98% water, 2% acetonitrile, 0.1% formic acid to reach a protein concentration of 0.5 µg/µL.
LC-MS/MS analysis
A 2 µL injection was analyzed by reversed phase nano-liquid chromatography-mass spectrometry (nano-LC-MS/MS) using an Easy-Nano-1200 nanoLC system (Thermo Scientific, San Jose, CA, USA) interfaced with an Orbitrap Exploris 480 (Thermo Scientific) Mass Spectrometer. The ‘trap and elute’ configuration consisted of a 0.075 mm × 20 mm C18 trap column with particle size of 3 µm (Thermo Scientific Accclaim PepMapTM 100, Part # 164946) in line with a 0.075 mm × 250 mm C18 nanoLC analytical column with particle size of 2 µm (Thermo Scientific PepMapTM, Part # ES902). Peptides were eluted using a solvent gradient of water containing 2% acetonitrile, 0.1% formic acid (MPA) and acetonitrile containing 20% water, 0.1% formic acid (MPB). MPB was held at 5% for 2 min, increased to 25% over 100 min, increased to 40% over 15 min, increased to 95% in 1 min, and was held at 95% for 13 min. Mass spectrometer parameters were set as follows: 2.0 kV positive ion mode spray voltage, ion transfer tube temperature of 275 °C, master scan cycle time of 3 s, m/z scan range of 375 to 1,600 at 120,000~ FWHM~ resolving power (at m/z 200), 300% normalized AGC Target, 120 ms maximum MS1 injection time, RF lens of 40%, 15,000~ FWHM~ resolving power (at m/z 200) for data-dependent MS2 scans, 0.7 m/z isolation window, 30% normalized HCD collision energy, 100% normalized AGC Target, automated maximum injection time and dynamic exclusion applied for 60 s periods.
Data Interrogation
Raw nanoLC-MS/MS files were processed with Proteome Discoverer 2.5 software (PD, Thermo Scientific, San Jose, CA) using *Danio rerio *(Taxon 7955) protein databases obtained from Swiss-Prot (3,274 sequences) and TrEMBL (83,386 sequences). A custom contaminants database was included in the searches to identify presence of human keratin and reagent enzyme peptides. Trypsin was designated as the cleaveage reagent with hydrolysis sites at the c-terminus of lysine and arginine. A label-free workflow was employed to obtain protein abundance values. The SEQUEST HT search node was set up with the following parameters: maximum of 3 missed cleavage sites; minimum peptide length of 6 amino acids; 5 ppm precursor mass tolerance; 0.02 Da fragment mass tolerance; maximum of 4 dynamic modifications per peptide, which were oxidation of methionine, n-terminal acetylation, and methionine loss; static carbamidomethylation of cysteine. Peptides were validated by Percolator with q-value set to 0.05 and strict false discovery rate (FDR) set to 0.01. Protein abundances were calculated using all peptides with normalization to total peptide amount. No scaling was performed. Hypothesis testing on replicate comparisons used ANOVA.
