Data from: A tailored MoS2 membrane with strong DNA binding capability enhances aquatic biota detection through environmental DNA metabarcoding
Data files
Mar 12, 2026 version files 881.81 MB
-
aquarium_0cm_1.fq.gz
21.46 MB
-
aquarium_0cm_2.fq.gz
22.80 MB
-
aquarium_10cm_1.fq.gz
45.91 MB
-
aquarium_10cm_2.fq.gz
48.52 MB
-
aquarium_15cm_1.fq.gz
24.55 MB
-
aquarium_15cm_2.fq.gz
26.18 MB
-
aquarium_5cm_1.fq.gz
62.39 MB
-
aquarium_5cm_2.fq.gz
66.17 MB
-
aquarium_con_1.fq.gz
59.23 MB
-
aquarium_con_2.fq.gz
62.85 MB
-
field_fcon_1.fq.gz
44.36 KB
-
field_fcon_2.fq.gz
47.24 KB
-
field_lcon_1.fq.gz
94.16 KB
-
field_lcon_2.fq.gz
98.38 KB
-
field_mce1_1.fq.gz
32.39 MB
-
field_mce1_2.fq.gz
34.28 MB
-
field_mce2_1.fq.gz
39.32 MB
-
field_mce2_2.fq.gz
41.31 MB
-
field_mce3_1.fq.gz
29.55 MB
-
field_mce3_2.fq.gz
31.39 MB
-
field_mos1_1.fq.gz
38.29 MB
-
field_mos1_2.fq.gz
40.28 MB
-
field_mos2_1.fq.gz
32.59 MB
-
field_mos2_2.fq.gz
35.10 MB
-
field_mos3_1.fq.gz
42.32 MB
-
field_mos3_2.fq.gz
44.63 MB
-
README.md
3.86 KB
Abstract
Active environmental DNA (eDNA) sampling, typically involving water filtration, offers the advantage of capturing relatively high concentrations of eDNA, making it particularly valuable in aquatic environments with low-DNA concentrations. However, this approach faces several limitations, including low DNA capture efficiency, limited molecular selectivity, and the risk of contamination during filtration and handling. Moreover, commonly used membrane materials often lack strong and specific DNA-binding affinity, which reduces detection sensitivity and compromises biodiversity assessment. To address these challenges, we developed a MoS2-coated mixed cellulose ester (MCE) membrane that significantly enhances both the efficiency and selectivity in capturing eDNA. The MoS2 coating facilitates preferential interactions with DNA via van der Waals forces between sulfur atoms in MoS2 and the oxygen or nitrogen atoms in DNA bases. Laboratory and field tests with marine fish confirmed that the MoS2-coated membrane significantly enhanced the selectivity and sensitivity of eDNA-based biota detection. This work represents the first application of a two-dimensional (2D) nanomaterial-based membrane for eDNA collection and detection. Furthermore, the membrane is low-cost, scalable, and requires no further processing. This invention offers a promising strategy for the development of 2D nanomaterials-based eDNA sampling tools and showcases their broader potential in environmental biotechnology applications.
Dataset DOI: 10.5061/dryad.3bk3j9kx5
Description of the data and file structure
This study incorporates molybdenum disulfide (MoS2) nanolaminates into eDNA sampling filters for potentially enhanced eDNA capture efficiency. We conducted two tests to examine the effects of nanolaminate coating on fish detection using an eDNA metabarcoding strategy, including detecting known fish from the laboratory aquarium, and a field test for detecting the marine fish community.
We conducted laboratory and field tests to examine the effects of MoS2 nanolaminates coating on the efficiency of eDNA metabarcoding for marine fishes. For aquarium testing, we collected and mixed 1 L of artificial seawater from four separate tanks cultivating coral fishes, including Eyestripe surgeonfish (Acanthurus dussumieri), Blue devil (Chrysiptera cyanea), Threespot dascyllus (Dascyllus trimaculatus), Stripey (Microcanthus strigatus), and Blue tang (Paracanthurus hepatus), and filtered onto MCE membranes with different amounts of MoS2 nanolaminates coating. The membranes were immediately extracted for the DNA.
For field tests, we collected water samples from Hoi Ha Wan Marine Park, Hong Kong (GPS: 22.4675473, 114.3301480). We collected three replicates of 4 L water using a Niskin sampler from a random site and filtered them onto the membranes in situ. The membranes were stored on ice in separate sterile Petri dishes and transferred to a -80 °C freezer in the laboratory. The membranes were extracted the next day after the sampling work. Based on the manufacturer's guidelines, the eDNA was extracted from the membranes using the DNeasy PowerSoil Pro Kit (Qiagen, Hilden, Germany). The quantity and quality of the DNA samples were assessed using Qubit dsDNA-HS Fluorescence Assay Kit (Invitrogen, Carlsbad, CA, USA), followed by PCR runs using 12S-V5 primer designated for vertebrate detection (F: AAGGCACTGGGATTAGATACCCC; R: AAGGCTAGAACAGGCTCCTCTAG). The PCR program comprised a 2-minute initial denaturation at 98 °C, followed by 35 cycles of denaturation at 98 °C for 10 seconds, annealing at 60 °C for 10 seconds, and extension at 68 °C for 5 seconds, culminating in a final extension at 68 °C for 2 minutes. The PCR products were checked for amplicon size and quantity before conducting paired-end 150 bp sequencing on a Novaseq 6000 platform offered by a sequencing service company (Novogene Co. Ltd., Beijing, China).
The raw sequences were stripped of index and primer sequences using Cutadapt (ver. 4.8), and the dataset provided is readily processed using various bioinformatics pipelines.
Files and variables
Files: aquarium_xx_1.fq.gz, aquarium_xx_2.fq.gz
Description: This series of .fq.gz files comprises the sequencing results from the aquarium test. The naming after the prefix "aquarium" indicates the sample ID, including a laboratory control (con) and membranes with different MoS2 nanolaminate thicknesses (0 cm, 5 cm, 10 cm, and 15 cm). The reads were paired-end sequences, with read-1 as forward and read-2 as reverse sequences.
Files: field_xx_1.fq.gz, field_xx_2.fq.gz
Description: This series of .fq.gz files comprises the sequencing results from the field test. The naming after the prefix "field" indicates the sample ID, including a laboratory control (lcon), a field control (fcon), MCE membranes (mce1, mce2, and mce3), and MoS2-coated MCE membranes (mos1, mos2, and mos3). The reads were paired-end sequences, with read-1 as forward and read-2 as reverse sequences.
The sequences were demultiplexed and stripped of primer sequences, which could be merged and quality filtered for subsequent processes.