Data for: Using environmental DNA to investigate avian interactions with flowering plant
Data files
Jan 10, 2023 version files 1.81 GB
-
classified_corrected_including_local_hits.txt
51.51 KB
-
classified.txt
46.86 KB
-
Ct_values.txt
6.85 KB
-
DADA2_nochim.otus
63.81 KB
-
DADA2_nochim.table
18.49 KB
-
Local_PNG.blasthits
32.86 KB
-
Pool1_PNG_L2_1.fq.gz
191.84 MB
-
Pool1_PNG_L2_2.fq.gz
196.91 MB
-
Pool1_PNG_L2_batchfileDADA2.list
92 B
-
Pool1_PNG_L2_tags.txt
504 B
-
Pool1_PNG_L4_1.fq.gz
681.02 MB
-
Pool1_PNG_L4_2.fq.gz
738.71 MB
-
Pool1_PNG_L4_batchfileDADA2.list
92 B
-
Pool1_PNG_L4_tags.txt
504 B
-
README.md
5.03 KB
Abstract
Animal pollination is an important and highly valued ecosystem function and the role of birds as pollinators is increasingly acknowledged. However, such interactions can be challenging to document and often require extensive field programs. Over the last decade, environmental DNA (eDNA) has been analysed from several different contemporary sample types such as water, soil, flowers, and air. The applications of these studies include biodiversity monitoring, detection of endangered species, community compositions, and, more recently, flower-arthropod interactions. However, it remains unknown whether flower-eDNA is applicable to other taxonomic groups interacting with plants, as well as the deposition and degradation of eDNA on flowers. Here, we test whether eDNA from flowers can be used for detecting bird pollinators. In a controlled environment (an aviary with great tits [Parus major]), we show that birds leave significant traces of DNA on the flowers without observed visits (airborne eDNA). We further show that when birds had been in contact with the flowers, DNA concentrations increased to levels significantly higher than airborne background DNA. Subsequently, we sampled five clusters of wild flowers in Papua New Guinea and detected four species of birds, two of which are nectar-feeders, and one that is an insectivorous species known to visit flowers. These four bird species were regularly seen in the area and caught in mist-nets in the days prior to sampling of the flowers. In total, 29 bird species were recorded (18 mist-netted) in the area and of these eight are nectarivorous. Our quantitative approach suggests that it is possible to distinguish airborne background bird DNA deposited on flowers from actual flower visits of birds in the wild, although this might be highly context specific. Our findings are of broad interest within research on ecosystem functioning, biotic interactions, and plant-animal mutualism.
The samples used for generating the HT sequencing data was collected in Papua New Guinea in November 2019. Detailed methods can be found in the connected publication.
DNA were extracted from the samples, and amplified by PCR, using the MiBird-U primers, targeting a 171 bp fragment of the mitochondrial 12S rRNA gene designed by Ushio et al. 2018 (doi:10.1038/s41598-018-22817-5).
Forward primer: GGGTTGGTAAATCTTGTGCCAGC
Reverse primer: CATAGTGGGGTATCTAATCCCAGTTTG
The libraries of amplified DNA from these samples have been sequenced using 150 bp paired end NovaSeq 6000 sequencing (150 BP PE).
The Ct values were generated from flower samples from an experimental setup with great tits (Parus major). Two experiments were conducted: One where flowers were placed in an aviary with great tits and flower samples were collected regularly, to investigate the amount of DNA deposited on flowers from birds in the vicinity, but who were not visiting the flowers. Another, where great tits were gently pushed into flowers, whereafter flower samples were collected over time, to investigate DNA degradation after deposition from visiting birds. Details can be found in the connected publication.
DNA were extracted from the samples, and Ct values were generated by qPCR, with the following primers and probe, specific to great tits:
| Name | Type | Sequence |
| ParmajCO1L | Forward Primer | CGCCCTAAGCCTCCTTATTC |
| ParmajCO1R | Reverse Primer | GTCAGTTTCCGAATCCTCCA |
| ParmajCO1L.Probe | Probe | 6FAM-CCTCCTGGGAGACGACCAAA-BHQ1 |
The dataset consist of 2 sequencing libraries containing DNA reads from 4 replicates of each of the 5 flower samples from Papua New Guinea, and one extraction control (CNE). All samples begin with "PNG" and the extraction controls are named "CNE".
The "tags" files contain a list of sample names and the tags used with the forward and reverse primer in the PCR reactions. The sample names are followed by the PCR replicate number ("_1","_2","_3","_4").
The "Ct_values.txt" contains all Ct values for each of the samples in the experimental part of the study.
Please se the README.md for additional usage notes. If you want to follow the data analysis done in the study, please see the connected publication for further details. Also, you are welcome to send an email with any questions that might come up.
