Data and code from: Comparison of environmental DNA and bulk DNA metabarcoding for assessing terrestrial arthropod diversity across three habitat types on Guam
Data files
Jul 16, 2026 version files 21.17 MB
-
guam_metadata_final.csv
388.48 KB
-
multiqc_report.html
20.77 MB
-
raw_fastq_files.tar.gz
29 B
-
README.md
9.34 KB
Abstract
DNA based methods offer a rapid and cost-effective way for detecting species occurrence and monitoring biodiversity; among them bulk DNA metabarcoding is well-established, and recently developed environmental DNA (eDNA)-based methods offer a non-destructive alternative. With a goal to develop suitable methods for assessing insect biodiversity in ecosystems for which DNA reference libraries are not well developed and incomplete, such as remote islands, we compared established bulk DNA metabarcoding methods with eDNA across three replicated terrestrial ecosystem types (limestone forest, degraded forest, and grassland) in Guam. Using two mitochondrial COI primer pairs, we performed bulk DNA metabarcoding of standard entomological collection methods (malaise traps, pan traps, vegetation beating), and compared assessment of biodiversity with that from different eDNA sources (flowers, spider webs, leaves, tree trunks). In our samples, eDNA and bulk DNA metabarcoding both detected a large proportion of overall taxa (OTUs, 86.6% and 60.3% respectively). Although DNA metabarcoding detected significantly more taxa than eDNA, eDNA proved to be a reasonable non-destructive alternative. As expected because of limitations in existing reference databases for remote habitats, species-level identification was achieved for only a few OTUs. Overall, the sampling approach was the dominant driver of arthropod diversity, explaining ~17% of the observed variation, while habitat type accounted for ~4%. Thus, each sampling approach captured some unique diversity signals, and contributed to the complementary effect of maximizing detection. For rapid insect biodiversity surveys of terrestrial arthropods, we recommend an integrated metabarcoding approach, and in sensitive habitats where insect capture is undesirable, eDNA offers a powerful alternative to monitor diversity and community change.
Dataset DOI: 10.5061/dryad.4f4qrfjsq
Description of the data and file structure
1. General Information
Title of Dataset
Comparison of environmental DNA and bulk DNA metabarcoding for assessing terrestrial arthropod diversity across three habitat types on Guam
Pritam Banerjee1, Samantha Al-Bayer2, Jerilyn Calaor3, Sven Weber1, Natalie Graham2, Jeremy C. Andersen4, Evan P. Economo5, Susan Kennedy6, Henrik Krehenwinkel6, George Roderick1, Rosemary Gillespie1, Haldre Rogers7, Kenneth P. Puliafico8
1Department of Environmental Science, Policy, and Management, University of California, Berkeley, California, USA
2Department of Biology, University of Hawaii at Hilo, Hilo, HI, United States
3Department of Ecology, Evolution, and Organismal Biology, Iowa State University, Ames, IA, USA
4Department of Environmental Conservation, University of Massachusetts, Amherst, MA, USA
5Biodiversity and Biocomplexity Unit, Okinawa Institute of Science and Technology Graduate University, Okinawa, Japan
6Department of Biogeography, Universität Trier, Trier, Germany
7Department of Fish and Wildlife Conservation, Virginia Tech, Blacksburg, Virginia, USA
8Center for Environmental Management of Military Lands, Colorado State University, Asan, Guam.
Date of Data Collection
- Sampling Period: 4th April 2023
Geographic Location
- Sampling Sites: Guam, USA
Contact Information
- Contact Person: Pritam Banerjee and Kenneth P. Puliafico
- Email: Pritam [pritam8683@gmail.com] and Ken [Ken.Puliafico@colostate.edu]
- Affiliation: Department of Environmental Science, Policy, and Management, University of California, University Avenue and Oxford St, Berkeley, CA 94720, USA (Pritam) and Center for Environmental Management of Military Lands, Colorado State University, Asan, Guam (Ken)
2. Dataset Description
Files Included
File: raw_fastq_files.tar.gz
Description: Raw sequence reads. Compressed archive containing all raw paired-end Illumina NextSeq FASTQ files generated from both bulk DNA and environmental DNA (eDNA) samples. The files include sequencing data from all sampling methods and biological replicates used in this study and can be re-analyzed using standard metabarcoding pipelines such as QIIME2, DADA2, or USEARCH.
File: multiqc_report.html
Description: Interactive MultiQC report summarizing sequencing quality metrics across all samples, including read counts, sequence quality scores, adapter trimming statistics, and other quality-control information generated during bioinformatic processing.
File: guam_metadata_final.csv
Description: Metadata file containing information for each sample, including sample identifiers, habitat type (limestone forest, degraded forest, and grassland), sampling method (bulk DNA and eDNA sources), collection site, and other relevant information required for reproducing the analyses and linking sequencing files to their corresponding samples
| Variable name | Description | Data type / Units | Possible values or notes |
|---|---|---|---|
island |
Island where the sample was collected. | Character | e.g., Guam |
location |
Unique sampling locality identifier. | Character | Site code assigned during field sampling. |
method_abb |
Abbreviation of the sampling method. | Character | (BT, beating sheets; FL, flower; LW, leaf wash; MT, malaise traps; SW, spider webs; TR, trunk rolling; WP, white pan; YP, yellow pan) |
primer |
PCR primer set used for metabarcoding amplification. | Character | e.g., MCO, ANML. |
sample_no |
Unique sample identification number. | Integer | Unique for each sample. |
i7_Index |
Illumina i7 index sequence assigned to the sample during library preparation. | Character | DNA nucleotide sequence. |
i5_Index |
Illumina i5 index sequence assigned to the sample during library preparation. | Character | DNA nucleotide sequence. |
Replica |
Biological or technical replicate identifier. | Integer | Replicate number used during laboratory processing. (Three technical for each samples) |
method |
Full Names of sampling method. | Character | BT, beating sheets; FL, flower; LW, leaf wash; MT, malaise traps; SW, spider webs; TR, trunk rolling; WP, white pan; YP, yellow pan |
detail_location |
Detailed description of the sampling locality. | Character | |
part_of_island |
Geographic region of the island where the sample was collected. | Character | e.g., northern, central, southern Guam. |
ObjectID |
Internal GIS record identifier. | Integer | Generated by the GIS database. |
GlobalID |
Globally unique GIS identifier for each record. | Character (UUID) | Automatically generated. |
Island |
Full island name. | Character | e.g., Guam. |
Collection_Team |
Person(s) or team responsible for sample collection. | Character | Collector names or initials. |
Date_and_Time |
Date and time of sample collection. | Date-time | Format: YYYY-MM-DD HH:MM |
Habitat |
Habitat type where the sample was collected. | Character | e.g., limestone forest, grassland, degraded forest |
Canopy_Cover_Percent |
Estimated canopy cover at the sampling site. | Percentage (%) | Values range from 0–100. |
Location_Remarks |
Additional notes describing the sampling location. | Character | Optional field. |
Field_Notes |
Additional observations recorded during sampling. | Character | Optional field. |
Image_IDs |
Identifier(s) of photographs associated with the sampling event. | Character | Image filenames or IDs. |
CreationDate |
Date when the GIS record was created. | Date-time | |
EditDate |
Date when the GIS record was last modified. | Date-time | |
x |
Longitude of the sampling location. | Decimal degrees | |
y |
Latitude of the sampling location. | Decimal degrees |
3. Usage Notes
- Raw Data:
- FASTQ files can be re-analyzed using bioinformatics pipelines such as QIIME2 or DADA2.
- R Scripts: see Github: Pritam8683
- Primers
- All DNA samples (except spider webs) were amplified using two universal degenerate primer pairs amplifying the mitochondrial COI (mt-DNA) barcoding region; (i) mlCOIintF (5′-GGWACWGGWTGAACWGTWTAYCCYCC-3′) and Fol-degen-rev (5′-TANACYTCNGGRTGNCCRAARAAYCA-3′); for 313-bp amplicon and (ii) LCO1490 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′) and CO1‐CFMRa (5′‐GGWACTAATCAATTTCCAAATCC‐3′); for 180-bp amplicon.
4. Licensing and Citation
License
CC0
Citation
Please cite this dataset as:
Banerjee, P., et al. (2026). Data and code from: Comparison of environmental DNA and bulk DNA metabarcoding for assessing terrestrial arthropod diversity across three habitat types on Guam. Dryad Digital Repository. Dataset DOI: 10.5061/dryad.4f4qrfjsq
5. Limitations
- The dataset reflects observations from specific geographic locations and sampling conditions.
- Interpretation of species interactions may require consideration of environmental and ecological context.
Sample Collection
DNA Extraction and Sequencing
- DNA was extracted using the DNeasy Blood & Tissue Kit.
- The mitochondrial COI gene was amplified for metabarcoding.
- Sequencing was conducted on the Illumina Nextseq.
Data Analysis
- Sequence reads were quality filtered and trimmed using Cutadapt (v3.4), DADA2.
- Taxonomic assignments were performed using NCBI Blast.
- Diversity analyses and visualizations were carried out in R using the vegan and phyloseq packages.
For more details: see Banerjee, P., Al‐Bayer, S., Calaor, J., Weber, S., Graham, N.R., Andersen, J.C., Economo, E.P., Kennedy, S., Krehenwinkel, H., Gillespie, R.G. and Roderick, G.K., 2026. Comparison of environmental DNA and bulk DNA metabarcoding for assessing terrestrial arthropod diversity across three habitat types on Guam. Molecular Ecology Resources, 26(5), p.e70172.