AAV vectors are mainstream delivery platforms in gene therapy, yet AAV-mediated gene transfer to adipose tissue is underdeveloped due to low efficiency of natural AAVs. We previously demonstrated that an engineered capsid Rec2 displayed improved adipo-tropism but with the caveat of liver transduction. To generate highly adipo-tropic capsid, we modified Rec2 capsid by site-specific mutagenesis and found the variant V7 with F503Y, Y708D and K709I substitution to harbor highly selective adipo-tropism while diminishing liver transduction. Intraperitoneal injection favored transduction to visceral fat while intravenous administration favored subcutaneous fat.  Intraperitoneal administration of V7 vector harboring human leptin and adiponectin as single transcript normalized the metabolic dysfunction of ob/ob mice at a low dose. Moreover, introducing the same mutagenesis to AAV8 capsid diminished liver transduction suggesting F503, Y708 and K709 critical for liver transduction. The Rec2.V7 vector may provide a powerful tool for basic research and potent vehicle for adipose-targeting gene therapy.

Rec2 capsid V7 mutagenesis

The Rec2 capsid was mutagenized at sites indicated in Figure1A and full capsid sequence is listed in Figure 1B. We name Rec2 variants as V1 to V8 in numerical order. GeneArt site-directed mutagenesis Plus kit (A14604, Invitrogen) was used to carry out the designated mutagenesis.  Rec2 capsid sequence is based on published data⁶. Primers for mutagenesis was synthesized by Sigma-Aldrich: F503Y (ACAACAATAGCAACTATGCCTGGACTGCTGG,CCAGCAGTCCAGGCATAGTTGCTATTGTTGT); Y708D and K709I (TACACCTCCAACTACGACATATCTACAAGTGTGGA, TCCACACTTGTAGATATGTCGTAGTTGGAGGTGTA).

Mutagenesis was set up and carried out according to the manufacturer’s instruction, and the nucleotide replacement at each site was confirmed by sequencing at the Core Facility of The Ohio State University, Comprehensive Cancer Center. The whole capsid was also sequenced and confirmed without unintended mutation.

AAV8 capsid mutation

Rec2 capsid was generated from capsid domain shuffling between rh20 and AAV8 ⁶ whose C-terminal including those three amino acids mutagenized for V7 is identical to AAV8 capsid C-terminal. As such, AAV8 capsid mutagenesis of F503Y, Y708D and K709I was conducted as described for V7 mutagenesis.

AAV vectors packaging

The rAAV vector backbone contains CBA (hybrid cytomegalovirus–chicken β-actin) promoter, woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and bovine growth hormone polyadenylation signal flanked by AAV2-inverted terminal repeats. Reporter gene—enhanced green fluorescent protein (referred as GFP) or therapeutic gene—human leptin cDNA and human adiponectin cDNA linked with a 2A sequence (referred as LEP/ADIPOQ) was cloned into polylinker sites of cis-plasmid as described previously ⁷. LEP/ADIPOQ sequence was synthesized by gBlock of IDT. Plasmids used for viral packaging were prepared by using EndoFree plasmid Maxi and Mega Kit (Qiagen). Human embryonic kidney 293 cells were co-transfected with three plasmids—rAAV plasmid or cis-plasmid, AAV trans-plasmid encoding rep and cap genes including Rec2, Rec2.V1 to V8, AAV8, and AAV8 mutant, and adenoviral helper pF Δ6—using standard CaPO₄ transfection. AAV was purified from the cell lysate by ultracentrifugation through an iodixanol density gradient (OptiPrep Density Gradient Medium, D1556, Sigma). AAV was tittered using quantitative PCR using Step OnePlus Real-Time PCR System (Applied Biosystems) with the Power SYBR Green PCR Master Mix (Applied Biosystems#A25742) ⁴⁷.

Administration of AAV vectors

AAV vectors were administered into mice either through i.p. injection in 150 µL AAV dilution buffer or via tail vein injection in 50 µL AAV dilution buffer. Doses ranging from 2E10 to 8E10 vg/mouse were used and specified in each experiment in figure legend.

GFP content measurement

GFP content was measured as previously described ⁹. In brief, tissues were homogenized in ice-cold RIPA buffer (25mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) supplemented with proteinase inhibitors cocktail, followed by briefly sonication. The mixture was then spun at 13,000 rpm for 15 min at 4 °C. The supernatant was collected. GFP fluorescence in 150 µL supernatant was measured with microreader (Synergy H1, Bio Tek Instrument) using a 485-nm excitation wavelength and cut-off 528-nm emission wavelength. GFP content was represented as readings after subtracting auto-fluorescence from GFP-null corresponding tissue and calibrated by either protein content in the samples or wet tissues weight.

ob/ob mice experiment

Male homozygous ob/ob mice (JAX 000632 B6.Cg-Lep^ob/J), seven weeks old, were randomly assigned to receive V7-GFP or V7-LEP/ADIPOQ. Sex and age-matched heterozygous ob/+ mice received AAV buffer as another control. Body weight and food intake were monitored weekly over the period of 9 weeks. One mouse from V7-LEP/ADIPOQ 4E10 group and one mouse from V7-LEP/ADIPOQ 8E10 group were excluded due to technical errors of administration.

Glucose tolerance test (GTT)

Eight weeks after i.p. administration of AAV vectors, mice were i.p. injected with glucose solution (1mg glucose per gram body weight) after overnight fast with water ad libitum. Blood was collected from the tail at various time points and the blood glucose concentrations were measured with a portable glucose meter (Bayer Contour Next).

Rectal temperature measurement

Temperature probe (Physitemp, model BAT-12) topped with lubricant (white petroleum jelly) was used to measure the rectal temperature of ob/ob mice at 8-weeks after i.p. administration of AAV vectors.

Body composition by EchoMRI

EchoMRI was used to measure body composition of fat and lean masses in live mice without anesthesia at 9-weeks post AAV injection. EchoMRI imaging was performed with a 3-in-1 Analyzer (EchoMRI LLC, Houston, TX) according to manufacturer instructions at Small Animal Imaging Core of The Dorothy M. Davis Heart & Lung Research Institute, Ohio State University. Mice were subjected to a 5-Gauss magnetic field and whole-body masses of fat, lean, free water, and total water were determined during separate cycles by manufacturer software comparison to a canola oil standard.

Serum harvest and analysis

Trunk blood was collected at euthanasia, clotted on ice, and centrifuged at 12,000 rpm for 15 min at 4°C. The serum was collected and stored at -20°C until further analysis. R&D Systems DuoSet ELISA kits were used to assay serum human leptin (R&D Systems, #DY398) and human adiponectin/Acrp30 (R&D Systems, # DY1065). Mouse serum insulin was measured with ELISA kit from ALPCO (ALPCO #80-INSMSU-E01). A Cayman Chemical colorimetric assay was used to determine serum glucose levels (#10009582).

Liver lipid extraction and triglycerides assay

Hepatic lipid was extracted from 50 mg of liver tissue from each animal by chloroform/methanol (2:1 v/v), followed by rinse in 50 mM NaCl and CaCl₂ (0.36M)/Methanol (1:1 v/v). An aliquot of the extract was mixed with Triton X100 and cold acetone, then was dried up and redissolved in PBS. Hepatic triglyceride quantification was performed with a Caymen Chemical triglyceride assay kit (Caymen Chemical, #10010303).

Immunoblotting

Tissues were homogenized in ice-cold Pierce RIPA buffer containing 1x Roche Phosstop and Calbiochem protease inhibitor cocktail III, then was subjected to brief sonication on ice. Tissues lysates were spun at 13,000 rpm for 15 min at 4 °C. The supernatant was collected, and the protein concentration was assayed with BCA protein assay kit (Piece).  20 µg of protein from each sample was loaded and separated by gradient gel (4-20%, Mini-PROTEAN TGX, Bio-Rad), then transferred to a nitrocellulose membrane (BIO-RAD). Blots were incubated overnight at 4 °C with the following primary antibodies, b-actin (Cell Signaling #4970, 1:1000), GFP (Santa Cruz Biotechnology, sc-9986 HRP, 1:1000). Chemiluminescence signal was detected and visualized by LI-COR Odyssey Fc imaging system (LI-COR Biotechnology, Lincoln, NE). Quantification analysis was carried out with image studio software version 5.2 (LI-COR Biotechnology).

Quantitative RT-PCR

Total RNA was isolated using the RNeasy Mini kit (QIAGEN) with RNase-free DNase treatment. cDNA was reverse transcribed using Taqman Reverse Transcription Reagents (Applied Biosystems). qPCR was carried out on StepOnePlus Real-Time PCR System using Power SYBR Green PCR Master Mix (Applied Biosystems). Primers were designed to detect GFP (GACTTCTTCAAGTCCGCCAT, TGTGGCTGTTGTAGTTGTACTC), ADIPOQ (AGGCAGGAAAGGAGAACCT, GTGGAGCCATCATAGTGGT), Gapdh (TCCCACTCTTCCACCTTCGA, TGCTGTAGCCGTATTCATTGTCA), and Actinb (ACCCGCGAGCACAGCTT, ATATCGTCATCCATGGCGAACT). Data were calibrated to Actinb and quantified using the 2 ^-DDCT method.

Viral vector copy number measurement

To assess vector biodistribution, viral vector copy number was measured as previously described. Briefly, total DNA from various tissues was isolated using DNesay Blood and Tissue kit (Qiagen). GFP fragment was amplified and quantified by qPCR to determine the copy number of viral particles. 50 ng of DNA from each sample was used for real-time PCR with either duplicate or triplicate. Mouse nucleic genomic DNA fragment of the GAPDH gene was used as a control for mouse genetic DNA. Genomic DNA of untreated animals was also used as negative control for the comparison. Data are expressed as copies of V7-GFP/50 ng of genomic DNA.

Quantification and Statistical analysis

Data are expressed as means ± SEM. GraphPad Prism 9 was used to analyze data. One-way ANOVAs with Tukey’s post hoc test were utilized for comparisons between three or four groups. Time course data (BWs, GTT) were analyzed using a mixed ANOVA and area under the curve calculations were performed where applicable. Normality was tested using the Shapiro-Wilk method. * Indicates p value < 0.05; ** indicates p value < 0.01 in figures.