Diverse ectomycorrhizal fungi communities found in urban reserve soils and scats of small mammals when compared to native forest
Data files
Dec 23, 2025 version files 21.41 MB
-
20241123_allasv_40r_biom.csv
8.72 MB
-
20241123_allasv_mat.csv
8.06 MB
-
20241123_allasv_taxmat.csv
2.37 MB
-
20241123_emf_sm_soil_hellinger_nozeros.csv
46.14 KB
-
20241123_sample_depth_40r.csv
5.08 KB
-
20241123_sample_depth.csv
5.36 KB
-
20241123_sp_mat_40r.csv
895.12 KB
-
20241123_sp_taxmat_40r.csv
385.82 KB
-
20241124_emf_kur_scat.csv
19.35 KB
-
20241124_emf_kur_soil.csv
7.05 KB
-
20241124_emf_urb_scat.csv
3.44 KB
-
20241124_emf_urb_soil.csv
7.51 KB
-
20241125_emf_astu-rfus_nozeros.csv
18.36 KB
-
20241125_emf_astuartii.csv
6.52 KB
-
20241125_emf_rfuscipes.csv
14.49 KB
-
20241125_emf_scat_nozeros.csv
21.26 KB
-
20241129_agaricoids_scat_nozeros.csv
11.06 KB
-
20241129_agaricoids_scat_soil_hellinger.csv
34.21 KB
-
20241129_hypogeous_scat_hellinger_nozeros.csv
12.21 KB
-
20241129_hypogeous_scat_soil_hellinger.csv
19.64 KB
-
20250429_fungi_ASV_AUS_V2.R
45.34 KB
-
20250628_emf_sm_soil_hellinger.csv
122.90 KB
-
20250628_sp80_40r_hellinger.csv
565.12 KB
-
README.md
13.70 KB
Abstract
Ectomycorrhizal fungi (EMF) play an essential role in forest health. In urban reserves, there is a complex interplay between environmental factors, including anthropogenic stressors that influence the composition and structure of EMF communities, which in turn may affect their plant hosts and the presence of small mammals as dispersers. We aimed to assess the response of EMF to urbanisation by comparing the diversity and composition of their communities in small mammal scats and soil samples from urban reserves to those in native forest sites through ITS1 barcoding. Additionally, we analysed the effect of seasonality and the identity of small mammal vectors on EMF diversity present in scat samples. The datasets linked to our analyses include csv files with the identified EMF species and their abundance in samples of small mammal scats and soil. We found that EMF diversity was strongly influenced by the sample type (soil vs. scats). In soil samples, EMF communities in urban reserves were as diverse as in forest sites, with similar richness and Shannon’s diversity index (H’); however, their composition differed. In scat samples, we found no differences in EMF richness, H’, or composition between site types. Seasonality did not affect EMF diversity in soil samples, while in scat samples, EMF diversity was higher in autumn, characterised by higher agaricoid EMF richness compared to scats collected in spring. Hypogeous gasteroid EMF richness was higher in scat samples collected in spring than in autumn. The lack of seasonal patterns we observed in our soil samples may reflect abrupt changes in rainfall in our study area. We found that scats of Antechinus stuartii had higher EMF diversity compared to those of Rattus fuscipes. This finding is surprising as A. stuartii is primarily insectivorous. We conclude that urban reserves serve as important refuges for EMF and that the small mammal vectors within these reserves may disperse a significantly diverse pool of EMF.
Dataset DOI: 10.5061/dryad.jwstqjqns
Description of the data and file structure
The files are in csv format and contain modified pre-curated and curated datasets used for the analyses. Soil and small mammal scat samples were collected in five forest sites and five urban reserves. The natural forest sites were located in Ku-ring-gai Chase National Park (KNP), whereas the five urban reserve sites were located around the boundary of KNP. For small mammal scat collection we sampled each pair of sites (forest and urban reserve) simultaneously for three consecutive nights. At each site, we installed 50 Elliot traps (33 cm x 8 cm x 9 cm) in a sampling grid spaced at 10 m intervals. We sampled the sites during both spring (September 2023) and autumn (April 2024) due to their contrasting rainfall patterns. Fresh scats were collected in 1.5 ml Eppendorf tubes from inside the Elliot traps when captures of small mammals occurred. In addition to the scat samples, we also collected three soil samples from each site in spring and two soil samples from each site in autumn. Soil samples were collected using a sterilised 5 cm diameter PVC tube to extract two soil cores from approximately 30 cm of the base of the trunk of Eucalyptus trees, each tree separated by at least 20 m from the next one. At each site, we sampled soils around 25 Eucalyptus trees per site in total. We combined the cores collected from five Eucalyptus trees (i.e., ten soil cores) into one sample, and a final sample was collected in a 1.5 ml Eppendorf tube. We collected a total of 50 soil samples. We extracted DNA from both the scat and soil samples after each sampling season using the DNeasy PowerSoil Pro kit from Qiagen® and following the manufacturer’s protocol.
The DNA samples were submitted to AGRF (https://www.agrf.org.au/) for library preparation and amplicon sequencing. The amplicons were generated using the fungal-specific primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC). The sequenced samples were processed with the DADA2 Pipeline in R. The taxonomic classification of the ASVs was performed using the UNITE database for fungi version 10.0 (Abarenkov et al., 2024).
Files and variables
File: 20241123_sample_depth.csv
Description: Data on sample depth of soil and scat samples collected in forest and urban reserves.
Variables
- ID: Consecutive identifier number
- sample: Sample ID
- depth: Sequence reading depth
- site_type: forest vs urban reserves
- site: site identifier
- sample_type: scat or soil
File: 20241123_allasv_mat.csv
Description: Matrix of all the ASV (Amplicon Sequent Variants)
Variables
- ASV_ID: ASV identifier
- K-1-1 to U-5-E2: Sample identifiers
File: 20241123_allasv_taxmat.csv
Description: Taxonomy matrix for all the ASV (Amplicon Sequent Variants)
Variables
- ASV_ID: Consecutive identifier number
- Kingdom: Taxonomy
- Phyllum: Taxonomy
- Class: Taxonomy
- Order: Taxonomy
- Family: Taxonomy
- Genus: Taxonomy
- Species: Taxonomy
- Taxonomy: Species
- boot.Genus: confidence for genus clasification
- boot.Species: confidence for species clasification
File: 20241123_allasv_40r_biom.csv
Description: BIOM file of taxonomy and samples.
Variables
- Kingdom: Taxonomy
- Phyllum: Taxonomy
- Class: Taxonomy
- Order: Taxonomy
- Family: Taxonomy
- Genus: Taxonomy
- Species: Taxonomy
- Taxonomy: Species
- boot.Genus.80: confidence for genus clasification
- boot.Species.80: confidence for genus clasification
- K.1.1 to U.5.E2: Sample identifiers. Row numbers represent the number of reads per species.
File: 20241123_sp_mat_40r.csv
Description: Matrix of ASV/species rarefied to 40,000 sequence depth per sample.
Variables
- ASV_mock: ASV identifier
- K.1.1 to U.5.E2 the row numbers represent the number of reads per ASV.
File: 20241123_sample_depth_40r.csv
Description: Sample depth of ASV rarefied to 40,000 sequence depth per sample.
Variables
- ID: Consecutive row number
- sample: Sample ID
- depth: Sequencing depth
- site_type: Forest vs urban reserve
- site: Site identifier
- sample_type: Soil or scat
File: 20241123_sp_taxmat_40r.csv
Description: Taxonomy matrix for rarefied to 40,000 sequence depth per sample
Variables
- ASV_mock: Consecutive ASV number
- Kingdom: Taxonomy
- Phyllum: Taxonomy
- Class: Taxonomy
- Order: Taxonomy
- Family: Taxonomy
- Genus: Taxonomy
- Species: Taxonomy
- Taxonomy: Species
- boot.Genus.80: Confidence clasification
- boot.Species.80: Confidence clasification
- reads.50: Number of reads per species
File: 20250628_sp80_40r_hellinger.csv
Description: Selection of mycorrhizal fungi species with a bootstrap confidence of at least 80%.
Variables
- sp_ID: Species number ID
- Kingdom: Taxonomy
- Phyllum: Taxonomy
- Class: Taxonomy
- Order: Taxonomy
- Family: Taxonomy
- Genus: Taxonomy
- Species: Taxonomy
- Taxonomy: Species taxonomy
- boot.Genus.80: Clasification confidence
- boot.Species.80: Clasification confidence
- reads.50: Number of reads per species
- K.1.1 to U.5.E2: Sample identifiers. Row values represent the number of reads per ectomycorrhizal fungi species.
File: 20250628_emf_sm_soil_hellinger.csv
Description: Fully curated dataset of ectomycorrhizal fungi found on each small mammal scat and soil sample.
Variables
- site: Site identifier
- sample.ID: Sample ID
- date: Sample collection date
- season: Season of collection (autumn vs spring)
- season.sample: combination of season and sample type
- sex: small mammal sex
- vector.genus: small mammal genus
- vector: small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (forest vs urban reserve)
- site.sample: combination between site type and sample type
- Amanita.fuscosquamosa to Xerocomus.squamulosus: Ectomycorrhizal fungi species. Row values represent Hellinger transformed sequence reads per sample.
File: 20241124_emf_urb_scat.csv
Description: Sequence data for scats collected in urban reserves.
Variables
- ID: Species ID
- U.3.2 to U.5.4: Sample identifiers. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241124_emf_urb_soil.csv
Description: Sequence data for soil collected in urban reserves.
Variables
- ID: Species ID
- U.2.E1 to U.3.C: Sample identifiers. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241124_emf_kur_soil.csv
Description: Sequence read data for soil collected in Ku-ring-gai Chase National Park.
Variables
- ID: Species ID
- K.5.C to K.3.B: Sample identifiers. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241124_emf_kur_scat.csv
Description: Sequence read data for scat collected in Ku-ring-gai Chase National Park.
Variables
- ID: Species ID
- K.3.18 to K.1.22: Sample identifiers. Row numbers represent Hellinger transformed sequence reads per species.
File: 20241123_emf_sm_soil_hellinger_nozeros.csv
Description: Variation of the main dataset without overall 0 values.
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season of collection
- trap.id: ID of the trap of capture
- sex: Small mammal sex
- host.genus: small mammal genus
- host.species: small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- nmds_id: nmds identifier
- Amanita.fuscosquamosa to Xerocomus.squamulosus: Ectomycorrhizal fungi species. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241125_emf_scat_nozeros.csv
Description: Variation of the main dataset for scats without overall 0 values.
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season of sample collection
- trap.id: ID of the trap of capture
- sex: Small mammal sex
- host.genus: Small mammal genus
- host.species: Small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- Austroboletus.asper to Xerocomus.squamulosus: Ectomycorrhizal fungi species. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241129_agaricoids_scat_soil_hellinger.csv
Description: Filtered data for agaricoid ectomycorrhizal fungi species.
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season of sample collection
- season.sample: combination between season and sample type
- sex: Small mammal sex
- vector.genus: Small mammal genus
- vector: Small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- Amanita.fuscosquamosa to Xerocomus.squamulosus: Ectomycorrhizal fungi species. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241129_agaricoids_scat_nozeros.csv
Description: Filtered data for agaricoid ectomycorrhizal fungi species without 0 values overall
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season of sample collection
- season.sample: combination between season and sample type
- sex: Small mammal sex
- vector.genus: Small mammal genus
- vector: Small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- Austroboletus.asper to Xerocomus.squamulosus: Ectomycorrhizal fungi species. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241129_hypogeous_scat_soil_hellinger.csv
Description: Filtered data for hypogeous ectomycorrhizal fungi species
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season of sample collection
- season.sample: combination between season and sample type
- sex: Small mammal sex
- vector.genus: Small mammal genus
- vector: Small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- Amylascus.herbertianus to Thaxterogaster.nebulobrunneus: Ectomycorrhizal fungi species. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241129_hypogeous_scat_hellinger_nozeros.csv
Description: Filtered data for hypogeous ectomycorrhizal fungi species without 0 overall.
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season of sample collection
- season.sample: combination between season and sample type
- sex: Small mammal sex
- vector.genus: Small mammal genus
- vector: Small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- Austrogautieria.costata to Thaxterogaster.nebulobrunneus: Ectomycorrhizal fungi species. Row numbers represent Hellinger transformed sequence reads per sample.
File: 20241125_emf_astuartii.csv
Description: Data filtered for Antechinus stuartii scat samples.
Variables
- ID: Ecotmycorrhizal fungi species
- K.3.11 to U.4.1: Sample ID. Row values represent number of reads per ectomycorrhizal fungi taxa per sample.
File: 20241125_emf_rfuscipes.csv
Description: Data filtered for Rattus fuscipes scat samples.
Variables
- ID: Ecotmycorrhizal fungi species
- K.3.18 to U.5.1: Sample ID. Row values represent number of reads per ectomycorrhizal fungi taxa per sample.
File: 20241125_emf_astu-rfus_nozeros.csv
Description: Data filtered for Antechinus stuartii and Rattus fuscipes scat samples without overall 0 values.
Variables
- site: Site identifier
- sample.ID: Sample identifier
- date: Sample collection date
- season: Season collection date
- trap.id: Trap of capture identifier
- sex: Small mammal sex
- vector.genus: Small mammal genus
- vector: Small mammal species
- sample.type: sample type (soil vs scat)
- site.type: site type (fores vs urban reserve)
- site.sample: combination between site type and sample type
- Austroboletus.asper to Xerocomus.squamulosus: Sample ID. Row values represent number of reads per ectomycorrhizal fungi taxa per sample.
Code/software
The code used in our analyses was developed by Margarita Gil-Fernandez, and can be found in the attached files under the name of 20250429_fungi_ASV_AUS_V2.R
The code was developed using R version 4.4.1, in RStudio 2025.05.1+513 "Mariposa Orchid" Release (ab7c1bc795c7dcff8f26215b832a3649a19fc16c, 2025-06-01) for windows
Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) RStudio/2025.05.1+513 Chrome/132.0.6834.210 Electron/34.5.1 Safari/537.36, Quarto 1.6.42
Access information
Other publicly accessible locations of the data:
Data was derived from the following sources:
