Descriptions

Comparing mRNA sequencing from mouse heart tissues in three wild-type (WT) and three PGRMC2 knockout (KO) samples.

Sample:

• WT.1, WT.2, WT.3, KO.1, KO.2, KO.3.
• WT stands for Wild-Type (control group).
• KO stands for Knockout (PGRMC2).
• The species being studied is Mus musculus (mouse)

FASTQ Entry data description:

1st Line (Identifier)

• LH00626 → The High-Throughput sequencing identification Tag number
• 19 → Run number.
• 22GHMLLT4 → Flow cell ID.
• 5 → Lane number.
• 1101 → Tile number on the flow cell.
• 12313:1056 → X and Y coordinates of the cluster on the tile.
• 1:N:0:ATGTGATT+AAGTAACG
o 1 → Read number (1 for forward read, 2 for reverse read in paired-end sequencing).
o N → Indicates if this read failed (Y) or passed (N) quality filters.
o 0 → Index number (likely a sample barcode).
o ATGTGATT+AAGTAACG → Dual index adapters used for multiplexing.

2nd Line (Nucleotide Sequence)

TNTAGTTCTAGTGCGATTAGGAATCCTAATACTGAAATAATTAGGGCTGTGGTTTTTAAAAATCATGGTATTGTGAGGACTGGAATGCTGGTTGGTGGAATATTATATGAGATGACAAATCCTGCAAAGATGCTTCCGAATGCAGATCGGA

• This is the actual DNA sequence obtained from sequencing.
• The "N" in the sequence indicates an ambiguous nucleotide (i.e., the sequencer was unsure of that nucleotide at that position).

3rd Line (Separator)

• This is a mandatory placeholder separating the sequence from the quality scores.

4th Line (Quality Scores)

• Each character corresponds to a Phred quality score for the respective nucleotide in the sequence.
• Higher ASCII character values indicate higher sequencing accuracy.
• I corresponds to a high-quality score, while # or - suggests lower confidence at those positions.

What Does This Mean?
• This is a single raw sequencing read from an Illumina sequencer.
• The identifier tells us about the sequencing run, flow cell, lane, tile, and position.
• The sequence contains the raw nucleotides, with N indicating uncertainty.
• The quality scores give confidence levels for each base.

Code/Software

FASTQ file format entry was used for next-generation sequencing (NGS) data of total mRNA sequencing data.

Whole transcriptome sequencing of six mouse samples yielded Illumina X Plus paired-end (PE) 100 bp reads.

These reads were QC analyzed using FastQC, trimmed with Trimmomatic, and aligned to the mouse mm10 reference genome using a splice-aware short-read aligner (HISAT2). Gene quantification was performed using Salmon and featureCounts, followed by differential expression analysis with DESeq2.