Data from: eDNA signals improve local predictions of fish abundances in Mediterranean coastal ecosystems
Data files
May 14, 2026 version files 35.20 KB
-
Coulon_et_al_2026_eDNA_data.csv
31.07 KB
-
README.md
4.13 KB
Abstract
Predicting marine species distribution and abundance is essential for effective conservation and management. Yet, it remains challenging in data-limited regions where traditional biodiversity surveys are logistically or financially constrained. Combining underwater visual census and eDNA fish sampling across the northwestern Mediterranean Sea, we tested a novel modelling framework that uses eDNA metabarcoding sequences to complement socio-environmental covariates in predicting species-specific local abundances. The eDNA-derived community proxies revealed ecological gradients complementary to visual census data, helping to distinguish sites dominated by coastal demersal fishes versus offshore predators, territorial reef fishes versus mobile dispersers, and benthic versus pelagic species. Using joint Species Distribution Models (jSDMs), within the Hierarchical Modelling of Species Communities (HMSC) framework, we compared the predictive performance of models based solely on socio-environmental covariates with those that additionally incorporated eDNA-based information. Including eDNA information significantly improved model fit for 16 out of 26 species, including the endangered dusky grouper (Epinephelus marginatus), and contributed to one-third of the explained variance in species local abundances on average. Synthesis and applications: This study demonstrates that integrating eDNA metabarcoding data into species distribution models can improve fish abundance predictions, especially for site-attached and reef-associated species. This approach provides a scalable and cost-effective tool for monitoring, impact assessment, spatial planning, and adaptive management of marine resources.
Dataset DOI: 10.5061/dryad.wstqjq321
Description of the data and file structure
We selected 348 eDNA samples collected between 2018 and 2023 across the northwestern Mediterranean Sea, using either surface or bottom sampling. Each sample consisted of 30 L of seawater collected along a 2-km transect parallel to the coastline and filtered within 30 min using a peristaltic pump and a VigiDNA 0.2 μm cross-flow filtration capsule (SPYGEN). After filtration, residual water was removed from the capsule, which was then filled with 80 ml of CL1 conservation buffer (SPYGEN) and stored at room temperature until DNA extraction. Metabarcoding was conducted using the ‘teleo’ marker (forward primer: ACACCGCCCGTCACTCT; reverse primer: CTTCCGGTACACTTACCATG) (Valentini et al., 2016), following the protocol of Pichot et al. (2025). Using a well-resolved reference database (up to 87% coverage in the western Mediterranean Sea), most Amplicon Sequence Variants (ASVs) (unique, error-corrected DNA sequences used as species proxies in eDNA studies) were assigned to species level. Only species detections supported by at least 10 reads per PCR replicates and occurring in more than two PCR replicates over 12 per sample were retained to minimize the influence of spurious ASV potentially resulting from PCR or sequencing errors (Mathon et al., 2023).
For model predictions, eDNA samples were spatially aggregated (mean = 5 samples per site) within 73 sites defined by 10-km-radius buffers. Because the dataset includes detections of endangered species, such as the dusky grouper (Epinephelus marginatus; EN), only aggregated data are shared.
Files and variables
File: Coulon_et_al_2026_eDNA_data.csv
Description:
Variables
- lon: longitude (°)
- lat: latitude (°)
- mpa_fully: 1 = No take zone
- depth_sampling: Depth at which filtration was carried out (m)
- date: Date at which filtration was carried out
- depth: Depth of the site (m)
- time_since_sunrise: Time elapsed since sunrise (hours)
- uo: Zonal current velocity (m.s-1)
- temperature: Sea surface temperature (°C)
- gravity: Human population size divided by travel time squared between the station and the population center. Calculated following the framework of Cinner et al. (2018), with travel time estimated using the global friction surface approach of Maire et al. (2016). Population centers within a 500 km radius buffer were included in the calculation.
- volume_filtered: Seawater filtered volume (L)
- habitat: Habitat types from the EUSeaMap 2023–EUNIS 2019 habitat classifications
- spygen_code_collapsed: Filters aggregated by 10-km-radius buffers
- n_visits: Number of visits
- Anthias anthias
- Aphia minuta
- Apogon imberbis
- Belone belone
- Boops boops
- Buenia affinis
- Carapus acus
- Chelon auratus
- Chelon labrosus
- Chelon ramada
- Chromis chromis
- Coris julis
- Crystallogobius linearis
- Dicentrarchus labrax
- Diplodus annularis
- Diplodus puntazzo
- Diplodus sargus
- Diplodus vulgaris
- Engraulis encrasicolus
- Gobius bucchichi
- Gobius niger
- Gobius xanthocephalus
- Lipophrys trigloides
- Lithognathus mormyrus
- Millerigobius macrocephalus
- Mola mola
- Mullus barbatus
- Mullus surmuletus
- Muraena helena
- Odondebuenia balearica
- Oedalechilus labeo
- Pagellus erythrinus
- Parablennius incognitus
- Pseudaphya ferreri
- Sardina pilchardus
- Sardinella aurita
- Sarpa salpa
- Sciaena umbra
- Scomber scombrus
- Scorpaena notata
- Scorpaena scrofa
- Serranus cabrilla
- Serranus scriba
- Sparus aurata
- Spicara maena
- Spondyliosoma cantharus
- Symphodus ocellatus
- Symphodus tinca
- Thalassoma pavo
- Torpedo marmorata
- Trachinus draco
- Tripterygion delaisi
- Tripterygion tripteronotum
- Xyrichtys novacula
- habitat_group
Access information
Data was derived from the following sources:
- EU Copernicus Marine Service Information
- EUSeaMap 2023–EUNIS 2019 habitat classifications (European Marine Observation and Data Network)
