The natural history of the model yeast Saccharomyces cerevisiae is poorly understood and confounded by domestication. In nature, S. cerevisiae and its undomesticated relative S. paradoxus are usually found on the bark of oak trees, a habitat very different from wine or other human fermentations. It is unclear whether the oak trees are really the primary habitat for wild yeast, or whether this apparent association is due to biased sampling. We use culturing and high-throughput environmental sequencing to show that S. paradoxus is a very rare member of the oak bark microbial community. We find that S. paradoxus can grow well on sterile medium made from oak bark, but that its growth is strongly suppressed when the other members of the community are present. We purified a set of twelve common fungal and bacterial species from the oak bark community and tested how each affected the growth of S. paradoxus in direct competition on oak bark medium at summer and winter temperatures, identifying both positive and negative interactions. One Pseudomonas species produces a diffusible toxin that suppresses S. paradoxus as effectively as either the whole set of twelve species together or the complete community present in nonsterilized oak medium. Conversely, one of the twelve species, Mucilaginibacter sp., had the opposite effect and promoted S. paradoxus growth at low temperatures. We conclude that, in its natural oak tree habitat, S. paradoxus is a rare species whose success depends on the much more abundant microbial species surrounding it.
ITS_taxonomy
Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the fungal ITS (ITS1, 5.8S and ITS2) sequences using ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers using the 454 GS FLX+ Titanium Sequencer (Roche).
ITS sequences were processed with mothur and subsampled to 4000 sequences per sample. For taxonomic classification the mothur implementation of naive Bayesian classification was used with a threshold bootstrap value of 70% for each taxonomic level. The used fungal database was the “dynamic” mothur release from 08.12.2013 of the UNITE database.
ITS.tax.summary
ITS_OTU
Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the fungal ITS (ITS1, 5.8S and ITS2) sequences using ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers using the 454 GS FLX+ Titanium Sequencer (Roche). We used the “pairwise.seqs” command in mothur for the OTU-based analysis with ignoring the penalization of the sequence ends. The shared file shows the distribution of OTUs in the ten groups at 97% and 95% identity level.
16S_taxonomy
Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the bacterial 16S rRNA (V1 to V5) sequences using GM3 (AGAGTTTGATCMTGGC) and 926R (CCGTCAATTCMTTTGAGTTT) primers using the 454 GS FLX+ Titanium Sequencer (Roche). 16S sequences were processed with mother, aligned to the comprehensive seed database from SILVA downloaded on April 29, 2013 and subsampled to 4000 sequences per sample. Sequence classification was performed using the mothur implementation of naive Bayesian classification based on the RDP Classifier version 9, with a threshold bootstrap value of 70% for each taxonomic level.
16S.tax.summary
16S_OTU
Six oak bark pieces (~1g) from four oak trees (three pieces from oak 1 and one piece from each of the other trees) in Northern Germany were collected. In addition an infusion (20g oak bark in a sterile tea bag in 300 mL water for 24 hours) for each tree was prepared. DNA was extracted from all samples using the Soil DNA Kit from Omega Bio-Tek. The resulting DNA was sent to LGC Genomics (GmbH, Berlin, Germany) for amplification of the bacterial 16S rRNA (V1 to V5) sequences using GM3 (AGAGTTTGATCMTGGC) and 926R (CCGTCAATTCMTTTGAGTTT) primers using the 454 GS FLX+ Titanium Sequencer (Roche). 16S sequences were processed with mother, aligned to the comprehensive seed database from SILVA downloaded on April 29, 2013 and subsampled to 4000 sequences per sample. We created a distance matrix of aligned sequences and clustered them into operational taxonomic units (OTUs) using the average neighbor clustering algorithm. The shared file shows the distribution of OTUs in the ten groups at 97% and 95% identity level.