Field sampling and taxonomic species identification:

Leaf beetle assemblages were sampled in 20 localities along a South-North transect (820 km) in Spain in April–June 2010. Each locality was separated from the closest locality by a minimum of 36 km [ALC-UBG] and a maximum of 106 km [ANC-EUM]. Sampling localities were selected to maximize the climatic variation and spanned an altitudinal range between 120 and 1270 m a.s.l. All localities were well preserved areas (most Natural Parks or areas with some degree of protection) combining forests dominated by different oak species, with shrubs and meadows. Each locality was intensively sampled by sweeping and beating all types of vegetation, including trees, shrubs and herbs, for 20 sampling periods of 30 min (18 sampling units in UBG). Collecting permits were issued by the corresponding regional governments: Junta de Andalucía (ALC, UBG, SNS), Junta de Extremadura (JCB, HOR, COR, VER, SSP, DEL), Junta de Castilla y León (FRN, ADS, ADN, SAN, OMA, TUE) and Xunta de Galicia (LAS, LAR, ANC, MAC, EUM). All specimens were preserved in 100% ethanol for DNA extraction. Specimens were identified to species level using the taxonomic monographs for the European (Warchalowski, 2003) and the Iberian (Petitpierre, 2000) leaf beetle faunas. When necessary, male and female genitalia were dissected and mounted together with specimens using dimethyl-hydantoin formaldehyde resin (DMHF).

Sequence data, DNA-based species delimitation and phylogenetic analysis:

Genomic DNA was extracted from muscle tissue in the prothorax region withWizard SV 96-well plates (Promega, UK) or with a BioSprint 96 workstation (Qiagen, Germany). A 655 base pair region from the 5′ end of mitochondrial cox1 was amplified with primers CO1F2 (TCTACYAATCATAAAGATATTGGTAC) and CO1R2 (ACTTCTGGATGACCAAAGAATCA) in most cases or with standard LCO/HCO primers (Folmer et al., 1994) when the previous primers failed. Amplification was performed with Bioline BioTaq and the following cycling: 95 °C for 2 min, 35 cycles of 95 °C for 30 s, 40 °C for 30 s and 72 °C for 45 s, and final extension of 72 °C for 5 min. PCR products were cleaned with 96-wellMilliporemultiscreen plates and sequenced in both directions using ABI dye terminator sequencing. Sequence chromatograms were assembled and manually edited using Genious 5.6. DNA sequences are available under GenBank accession numbers KF134544 – KF134651 and KF652242 – KF656666.